Search
LOADING 
- SNP ID:
- rs200294440
- Gene
-
MIR3912NPM1 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.5: 171391367 - 171391367 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
TTGTTGAAGCAGAGGCAATGAATTA[C/T]GAAGGCAGTCCAATTAAAGTAACAC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 164040
|
||||||||||||||||||||
Literature Links: |
MIR3912 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| MIR3912 - microRNA 3912 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| NPM1 - nucleophosmin | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001037738.2 | Intron | NP_001032827.1 | ||||
| NM_002520.6 | Intron | NP_002511.1 | ||||
| NM_199185.3 | Intron | NP_954654.1 | ||||
| XM_005265920.3 | Intron | XP_005265977.1 | ||||
| XM_011534564.1 | Intron | XP_011532866.1 | ||||
Back To Top