Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Quem atendemos
    • Setor de Biotecnologia
    • Indústria Biofarmacêutica
    • CDMO
    • Diagnósticos Laboratoriais
    • Ciência Industrial e Aplicada
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_191493410_10
          See other PTGER4 GT Assays ›
          SNP ID:
          rs199542450
          Gene
          PTGER4
          Gene Name
          prostaglandin E receptor 4
          Set Membership:
          -
          Chromosome Location:
          Chr.5: 40681682 - 40681682 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          TCGCTGGGCACCGAGCAGCACCACG[A/C]GGCCGCGGCCGCCTCGGTTGCCTCC

          Assay ID C_191493410_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601586

          Literature Links:

          PTGER4 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          PTGER4 - prostaglandin E receptor 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000958.2 1281 Missense Mutation GAG,GCG E,A 230 NP_000949.1
          XM_017009656.1 1281 Missense Mutation GAG,GCG E,A 230 XP_016865145.1
          XM_017009657.1 1281 Missense Mutation GAG,GCG E,A 230 XP_016865146.1
          XM_017009658.1 1281 Missense Mutation GAG,GCG E,A 230 XP_016865147.1
          XM_017009659.1 1281 Missense Mutation GAG,GCG E,A 230 XP_016865148.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of peptide secretion
          immune response
          adenylate cyclase-modulating G-protein coupled receptor signaling pathway
          adenylate cyclase-activating G-protein coupled receptor signaling pathway
          positive regulation of cytosolic calcium ion concentration
          JNK cascade
          female pregnancy
          positive regulation of cell proliferation
          response to mechanical stimulus
          positive regulation of gene expression
          negative regulation of hydrogen peroxide metabolic process
          regulation of circadian sleep/wake cycle, wakefulness
          positive regulation of smooth muscle cell migration
          positive regulation of cAMP biosynthetic process
          response to lipopolysaccharide
          response to progesterone
          positive regulation of interleukin-8 production
          negative regulation of integrin activation
          positive regulation of urine volume
          positive regulation of renal sodium excretion
          T-helper cell differentiation
          negative regulation of circadian sleep/wake cycle, REM sleep
          chemokinesis
          response to drug
          positive regulation of tyrosine phosphorylation of Stat3 protein
          response to amino acid
          positive regulation of osteoblast differentiation
          positive regulation of bone resorption
          positive regulation of cell adhesion
          positive regulation of circadian sleep/wake cycle, non-REM sleep
          negative regulation of cytokine secretion
          negative regulation of interleukin-1 alpha secretion
          positive regulation of cytokine secretion
          negative regulation of inflammatory response
          positive regulation of inflammatory response
          regulation of stress fiber assembly
          negative regulation of nitric-oxide synthase biosynthetic process
          maternal process involved in parturition
          bone development
          positive regulation of mucus secretion
          ERK1 and ERK2 cascade
          cellular response to mechanical stimulus
          cellular response to glucose stimulus
          cellular response to interleukin-1
          cellular response to prostaglandin E stimulus
          positive regulation of wound healing
          ductus arteriosus closure
          positive regulation of hyaluronan biosynthetic process
          response to salt
          negative regulation of ductus arteriosus closure
          negative regulation of small intestine smooth muscle contraction
          positive regulation of calcitonin secretion
          positive regulation of chemokinesis
          positive regulation of matrix metallopeptidase secretion
          negative regulation of tumor necrosis factor secretion
          negative regulation of endothelin secretion
          positive regulation of substance P secretion, neurotransmission
          response to water-immersion restraint stress
          positive regulation of antral ovarian follicle growth
          positive regulation of neutrophil extravasation
          negative regulation of eosinophil extravasation
          positive regulation of interleukin-10 secretion
          prostaglandin E receptor activity
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline