Search
LOADING 
- SNP ID:
- rs200074250
- Gene
-
GJC3LOC101927610TRIM4 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.7: 99929556 - 99929556 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
TCCCAGGAGCACGGGAAGCAAGAGG[C/T]GCCCCACGGGGGTGGAGCGCCGGCT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611925
|
||||||||||||||||||||
Literature Links: |
GJC3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| GJC3 - gap junction protein gamma 3 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_181538.2 | 65 | Missense Mutation | CAC,CGC | H,R 22 | NP_853516.1 | |
| LOC101927610 - uncharacterized LOC101927610 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| TRIM4 - tripartite motif containing 4 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top