Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_191815510_10
          See other CUL1 GT Assays ›
          SNP ID:
          rs201616806
          Gene
          CUL1 EZH2
          Gene Name
          cullin 1
          enhancer of zeste 2 polycomb repressive complex 2 subunit
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 148810379 - 148810379 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          AGCTGCACATGTATTTATCATACAC[C/T]TTCCCTCTTCTGTCAGCTTCATCTT

          Assay ID C_191815510_10
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603134 MIM: 601573

          Literature Links:

          CUL1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CUL1 - cullin 1
          There are no transcripts associated with this gene.
          EZH2 - enhancer of zeste 2 polycomb repressive complex 2 subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001203247.1 4502 Silent Mutation AAA,AAG K,K 656 NP_001190176.1
          NM_001203248.1 4502 Silent Mutation AAA,AAG K,K 647 NP_001190177.1
          NM_001203249.1 4502 Silent Mutation AAA,AAG K,K 605 NP_001190178.1
          NM_004456.4 4502 Silent Mutation AAA,AAG K,K 661 NP_004447.2
          NM_152998.2 4502 Silent Mutation AAA,AAG K,K 617 NP_694543.1
          XM_005249962.4 4502 Silent Mutation AAA,AAG K,K 664 XP_005250019.1
          XM_005249963.4 4502 Silent Mutation AAA,AAG K,K 655 XP_005250020.1
          XM_005249964.4 4502 Silent Mutation AAA,AAG K,K 613 XP_005250021.1
          XM_011515883.2 4502 Silent Mutation AAA,AAG K,K 669 XP_011514185.1
          XM_011515884.2 4502 Silent Mutation AAA,AAG K,K 661 XP_011514186.1
          XM_011515885.2 4502 Silent Mutation AAA,AAG K,K 660 XP_011514187.1
          XM_011515886.2 4502 Silent Mutation AAA,AAG K,K 653 XP_011514188.1
          XM_011515887.2 4502 Silent Mutation AAA,AAG K,K 652 XP_011514189.1
          XM_011515888.2 4502 Silent Mutation AAA,AAG K,K 652 XP_011514190.1
          XM_011515889.2 4502 Silent Mutation AAA,AAG K,K 639 XP_011514191.1
          XM_011515890.2 4502 Silent Mutation AAA,AAG K,K 630 XP_011514192.1
          XM_011515891.2 4502 Silent Mutation AAA,AAG K,K 628 XP_011514193.1
          XM_011515892.2 4502 Silent Mutation AAA,AAG K,K 627 XP_011514194.1
          XM_011515893.2 4502 Silent Mutation AAA,AAG K,K 625 XP_011514195.1
          XM_011515894.2 4502 Silent Mutation AAA,AAG K,K 622 XP_011514196.1
          XM_011515895.2 4502 Silent Mutation AAA,AAG K,K 621 XP_011514197.1
          XM_011515896.2 4502 Silent Mutation AAA,AAG K,K 583 XP_011514198.1
          XM_011515897.2 4502 Silent Mutation AAA,AAG K,K 552 XP_011514199.1
          XM_011515898.2 4502 Silent Mutation AAA,AAG K,K 552 XP_011514200.1
          XM_011515899.2 4502 Intron XP_011514201.1
          XM_011515901.2 4502 Intron XP_011514203.1
          XM_017011817.1 4502 Silent Mutation AAA,AAG K,K 669 XP_016867306.1
          XM_017011818.1 4502 Silent Mutation AAA,AAG K,K 648 XP_016867307.1
          XM_017011819.1 4502 Silent Mutation AAA,AAG K,K 622 XP_016867308.1
          XM_017011820.1 4502 Silent Mutation AAA,AAG K,K 613 XP_016867309.1
          XM_017011821.1 4502 Silent Mutation AAA,AAG K,K 547 XP_016867310.1

          Back To Top

          추가 정보


          Panther Classification:

          Molecular Function -

          histone modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          DNA methylation
          chromatin organization
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          positive regulation of epithelial to mesenchymal transition
          regulation of gliogenesis
          skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration
          cerebellar cortex development
          hippocampus development
          response to estradiol
          negative regulation of transcription elongation from RNA polymerase II promoter
          regulation of cell proliferation
          regulation of circadian rhythm
          positive regulation of MAP kinase activity
          negative regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of GTPase activity
          negative regulation of epidermal cell differentiation
          negative regulation of gene expression, epigenetic
          negative regulation of transcription, DNA-templated
          negative regulation of retinoic acid receptor signaling pathway
          rhythmic process
          negative regulation of striated muscle cell differentiation
          cellular response to hydrogen peroxide
          G1 to G0 transition
          histone H3-K27 methylation
          protein localization to chromatin
          positive regulation of protein serine/threonine kinase activity
          positive regulation of dendrite development
          negative regulation of G1/S transition of mitotic cell cycle
          core promoter binding
          DNA binding
          chromatin binding
          RNA binding
          protein binding
          protein-lysine N-methyltransferase activity
          histone-lysine N-methyltransferase activity
          chromatin DNA binding
          histone methyltransferase activity
          ribonucleoprotein complex binding
          sequence-specific DNA binding
          histone methyltransferase activity (H3-K27 specific)
          promoter-specific chromatin binding

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline