Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_25625804D_20
          See other CYP2C9 GT Assays ›
          SNP ID:
          rs7900194
          Gene
          CYP2C9
          Gene Name
          cytochrome P450 family 2 subfamily C member 9
          Set Membership:
          > DME > Validated > Inventoried
          Chromosome Location:
          Chr.10: 94942309 - 94942309 on Build GRCh38
          Polymorphism:
          T/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          GAGGACCGTGTTCAAGAGGAAGCCC[T/G]CTGCCTTGTGGAGGAGTTGAGAAAA

          Assay ID C_25625804D_20
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601130

          Literature Links:

          CYP2C9 PubMed Links

          Allele Nomenclature:

          CYP2C9*27,c.449G>T CYP2C9*27,g.3627G>T CYP2C9*8,c.449G>A CYP2C9*8,g.3627G>A

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.01)
          (0.99)
          Caucasian
          T (0.00)
          (1.00)
          CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          Caucasian
          A (0.00)
          (1.00)
          YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          African American
          T (0.00)
          (1.00)
          CHB (Han Chinese) - Not Available
          AFR
          A (0.05)
          (0.95)
          African American
          A (0.04)
          (0.96)
          JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          Japanese
          T (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          Japanese
          A (0.00)
          (1.00)
          Chinese
          T (0.00)
          (1.00)
          Chinese
          A (0.00)
          (1.00)
          CYP2C9 - cytochrome P450 family 2 subfamily C member 9
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000771.3 474 Missense Mutation CAC,CGC H,R 150 NP_000762.2
          XM_017015758.1 474 Missense Mutation CAC,CGC H,R 150 XP_016871247.1

          Back To Top

          More Information


          Important Information

          Assay C_25625804D_20 reports the major (G) and one minor (T) allele (CYP2C9*27, g.3627G>T) of a triallelic SNP. Assay C__25625804_10 reports the major (G) and other minor (A) allele (CYP2C9*8, g.3627G>A). The minor alleles are rare, thus there is a low risk that sample genotypes could be miscalled in an assay due to the presence of the unreported minor allele. To accurately determine sample genotypes, run both assays separately on the same samples and analyze data as described in the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 5 section 'TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets'.
          Assay C__25625804_10 reports the major (G) and other minor (A) allele (CYP2C9*8, g.3627G>A).

          Set Membership:

          DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          oxidoreductase oxygenase metabolite interconversion enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          xenobiotic metabolic process
          steroid metabolic process
          monoterpenoid metabolic process
          drug metabolic process
          epoxygenase P450 pathway
          urea metabolic process
          monocarboxylic acid metabolic process
          drug catabolic process
          exogenous drug catabolic process
          cellular amide metabolic process
          oxidation-reduction process
          oxidative demethylation
          omega-hydroxylase P450 pathway
          cholesterol 25-hydroxylase activity
          monooxygenase activity
          iron ion binding
          drug binding
          arachidonic acid epoxygenase activity
          steroid hydroxylase activity
          oxidoreductase activity
          (S)-limonene 6-monooxygenase activity
          (S)-limonene 7-monooxygenase activity
          oxygen binding
          heme binding
          caffeine oxidase activity
          (R)-limonene 6-monooxygenase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-knt4q:80/100.66.75.14:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0