Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_25625804D_20
          See other CYP2C9 GT Assays ›
          SNP ID:
          rs7900194
          Gene
          CYP2C9
          Gene Name
          cytochrome P450 family 2 subfamily C member 9
          Set Membership:
          > DME > Validated > Inventoried
          Chromosome Location:
          Chr.10: 94942309 - 94942309 on Build GRCh38
          Polymorphism:
          T/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          GAGGACCGTGTTCAAGAGGAAGCCC[T/G]CTGCCTTGTGGAGGAGTTGAGAAAA

          Assay ID C_25625804D_20
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601130

          Literature Links:

          CYP2C9 PubMed Links

          Allele Nomenclature:

          CYP2C9*27,c.449G>T CYP2C9*27,g.3627G>T CYP2C9*8,c.449G>A CYP2C9*8,g.3627G>A

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.01)
          (0.99)
          Caucasian
          T (0.00)
          (1.00)
          CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          Caucasian
          A (0.00)
          (1.00)
          YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          African American
          T (0.00)
          (1.00)
          CHB (Han Chinese) - Not Available
          AFR
          A (0.05)
          (0.95)
          African American
          A (0.04)
          (0.96)
          JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          Japanese
          T (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          Japanese
          A (0.00)
          (1.00)
          Chinese
          T (0.00)
          (1.00)
          Chinese
          A (0.00)
          (1.00)
          CYP2C9 - cytochrome P450 family 2 subfamily C member 9
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000771.3 474 Missense Mutation CAC,CGC H,R 150 NP_000762.2
          XM_017015758.1 474 Missense Mutation CAC,CGC H,R 150 XP_016871247.1

          Back To Top

          More Information


          Important Information

          Assay C_25625804D_20 reports the major (G) and one minor (T) allele (CYP2C9*27, g.3627G>T) of a triallelic SNP. Assay C__25625804_10 reports the major (G) and other minor (A) allele (CYP2C9*8, g.3627G>A). The minor alleles are rare, thus there is a low risk that sample genotypes could be miscalled in an assay due to the presence of the unreported minor allele. To accurately determine sample genotypes, run both assays separately on the same samples and analyze data as described in the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 5 section 'TaqMan DME genotyping assays to triallelic SNPs and adjacent SNP targets'.
          Assay C__25625804_10 reports the major (G) and other minor (A) allele (CYP2C9*8, g.3627G>A).

          Set Membership:

          DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          oxidoreductase oxygenase metabolite interconversion enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          xenobiotic metabolic process
          steroid metabolic process
          monoterpenoid metabolic process
          drug metabolic process
          epoxygenase P450 pathway
          urea metabolic process
          monocarboxylic acid metabolic process
          drug catabolic process
          exogenous drug catabolic process
          cellular amide metabolic process
          oxidation-reduction process
          oxidative demethylation
          omega-hydroxylase P450 pathway
          cholesterol 25-hydroxylase activity
          monooxygenase activity
          iron ion binding
          drug binding
          arachidonic acid epoxygenase activity
          steroid hydroxylase activity
          oxidoreductase activity
          (S)-limonene 6-monooxygenase activity
          (S)-limonene 7-monooxygenase activity
          oxygen binding
          heme binding
          caffeine oxidase activity
          (R)-limonene 6-monooxygenase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline