Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_305000833_10
          See other CRH GT Assays ›
          SNP ID:
          rs561061658
          Gene
          CRH TRIM55
          Gene Name
          corticotropin releasing hormone
          tripartite motif containing 55
          Set Membership:
          -
          Chromosome Location:
          Chr.8: 66179013 - 66179013 on Build GRCh38
          Polymorphism:
          C/A, Transversion substitution
          Context Sequence [VIC/FAM]:

          CTAGAGACAGAGTCCCACCATCTTT[C/A]TGCCTGGAAAAGAATGAAGCATCAG

          Assay ID C_305000833_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 122560 MIM: 606469

          Literature Links:

          CRH PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CRH - corticotropin releasing hormone
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000756.3 Intron NP_000747.1
          XM_017013090.1 Intron XP_016868579.1
          XM_017013091.1 Intron XP_016868580.1
          XM_017013092.1 Intron XP_016868581.1
          XM_017013093.1 Intron XP_016868582.1
          TRIM55 - tripartite motif containing 55
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          peptide hormone

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of protein phosphorylation
          synaptic transmission, dopaminergic
          glucocorticoid biosynthetic process
          inflammatory response
          signal transduction
          chemical synaptic transmission
          female pregnancy
          parturition
          learning or memory
          positive regulation of cell proliferation
          associative learning
          hormone-mediated apoptotic signaling pathway
          positive regulation of gene expression
          negative regulation of gene expression
          negative regulation of norepinephrine secretion
          positive regulation of circadian sleep/wake cycle, wakefulness
          positive regulation of cell death
          regulation of serotonin secretion
          diterpenoid metabolic process
          hypothalamus development
          lung development
          adrenal gland development
          positive regulation of cAMP biosynthetic process
          negative regulation of epinephrine secretion
          negative regulation of luteinizing hormone secretion
          locomotory exploration behavior
          positive regulation of insulin secretion involved in cellular response to glucose stimulus
          response to immobilization stress
          negative regulation of circadian sleep/wake cycle, REM sleep
          response to drug
          response to estrogen
          response to ethanol
          response to ether
          negative regulation of blood pressure
          response to pain
          ion homeostasis
          response to corticosterone
          positive regulation of corticotropin secretion
          positive regulation of cortisol secretion
          long-term synaptic potentiation
          positive regulation of digestive system process
          negative regulation of cell death
          negative regulation of glucagon secretion
          cellular response to cocaine
          cellular response to dexamethasone stimulus
          positive regulation of calcium ion import
          regulation of N-methyl-D-aspartate selective glutamate receptor activity
          positive regulation of corticosterone secretion
          positive regulation of behavioral fear response
          receptor binding
          hormone activity
          neuropeptide hormone activity
          protein binding
          corticotropin-releasing hormone activity
          corticotropin-releasing hormone receptor 1 binding
          corticotropin-releasing hormone receptor 2 binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline