Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Serviços Empresariais
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_305686226_10
          See other CNOT7 GT Assays ›
          SNP ID:
          rs573154707
          Gene
          CNOT7 ZDHHC2
          Gene Name
          CCR4-NOT transcription complex subunit 7
          zinc finger DHHC-type containing 2
          Set Membership:
          -
          Chromosome Location:
          Chr.8: 17227723 - 17227723 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          TAGTCTGATACTGTCAGTCTATTCT[T/C]TTACCAGTTATGGTGACACTGCATT

          Assay ID C_305686226_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 604913

          Literature Links:

          CNOT7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CNOT7 - CCR4-NOT transcription complex subunit 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001322087.1 4291 Intron NP_001309016.1
          NM_001322088.1 4291 Intron NP_001309017.1
          NM_001322089.1 4291 Intron NP_001309018.1
          NM_001322090.1 4291 Intron NP_001309019.1
          NM_001322091.1 4291 Intron NP_001309020.1
          NM_001322092.1 4291 Intron NP_001309021.1
          NM_001322093.1 4291 Intron NP_001309022.1
          NM_001322094.1 4291 Intron NP_001309023.1
          NM_001322095.1 4291 Intron NP_001309024.1
          NM_001322096.1 4291 Intron NP_001309025.1
          NM_001322097.1 4291 Intron NP_001309026.1
          NM_001322098.1 4291 Intron NP_001309027.1
          NM_001322099.1 4291 Intron NP_001309028.1
          NM_001322100.1 4291 Intron NP_001309029.1
          NM_013354.6 4291 Intron NP_037486.2
          NM_054026.3 4291 Intron NP_473367.2
          XM_005273481.2 4291 UTR 3 XP_005273538.1
          ZDHHC2 - zinc finger DHHC-type containing 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_016353.4 4291 Intron NP_057437.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          mRNA polyadenylation factor

          Gene Ontology Categories:

          Function(s) Process(es)

          nuclear-transcribed mRNA poly(A) tail shortening
          deadenylation-dependent decapping of nuclear-transcribed mRNA
          carbohydrate metabolic process
          transcription, DNA-templated
          DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest
          signal transduction
          positive regulation of cell proliferation
          negative regulation of cell proliferation
          negative regulation of gene expression
          gene silencing by RNA
          cytoplasmic mRNA processing body assembly
          gene silencing by miRNA
          exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of nuclear-transcribed mRNA poly(A) tail shortening
          positive regulation of mRNA catabolic process
          RNA phosphodiester bond hydrolysis, exonucleolytic
          positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay
          protein palmitoylation
          cellular protein metabolic process
          3'-5'-exoribonuclease activity
          transcription factor activity, sequence-specific DNA binding
          RNA binding
          exoribonuclease activity
          poly(A)-specific ribonuclease activity
          signal transducer activity
          protein binding
          metal ion binding
          zinc ion binding
          palmitoyltransferase activity
          protein-cysteine S-palmitoyltransferase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-7tj7t:80/100.66.75.107:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0