Search
LOADING 
- SNP ID:
- rs796931005
- Gene
-
POLB - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.8: 42348471 - 42348471 on Build GRCh38
- Polymorphism:
- G/A, Transition substitution
- Context Sequence [VIC/FAM]:
TTGGAATGTGCAGTTCCAGAGCAGC[G/A]CTTCTTAGAACAAGGTGTCTAGGCC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 174760
|
||||||||||||||||||||
Literature Links: |
POLB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| POLB - DNA polymerase beta | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_002690.2 | Intron | NP_002681.1 | ||||
| XM_005273535.3 | Intron | XP_005273592.1 | ||||
| XM_005273536.3 | Intron | XP_005273593.1 | ||||
| XM_005273537.3 | Intron | XP_005273594.1 | ||||
| XM_005273538.2 | Intron | XP_005273595.1 | ||||
| XM_005273539.2 | Intron | XP_005273596.1 | ||||
| XM_005273540.4 | Intron | XP_005273597.1 | ||||
| XM_006716353.2 | Intron | XP_006716416.1 | ||||
| XM_017013583.1 | Intron | XP_016869072.1 | ||||
| XM_017013584.1 | Intron | XP_016869073.1 | ||||
Back To Top