Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_307951026_10
          See other FGFR1 GT Assays ›
          SNP ID:
          rs869025669
          Gene
          FGFR1
          Gene Name
          fibroblast growth factor receptor 1
          Set Membership:
          -
          Chromosome Location:
          Chr.8: 38427970 - 38427970 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AGGTTTGAATTCTTTGCCATTTTTC[A/G]ACCAGCGCAGTGTGGGGTTTGGGGT

          Assay ID C_307951026_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 136350

          Literature Links:

          FGFR1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          FGFR1 - fibroblast growth factor receptor 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001174063.1 413 Missense Mutation TCG,TTG S,L 191 NP_001167534.1
          NM_001174064.1 413 Missense Mutation TCG,TTG S,L 183 NP_001167535.1
          NM_001174065.1 413 Missense Mutation TCG,TTG S,L 189 NP_001167536.1
          NM_001174066.1 413 Missense Mutation TCG,TTG S,L 102 NP_001167537.1
          NM_001174067.1 413 Missense Mutation TCG,TTG S,L 222 NP_001167538.1
          NM_015850.3 413 Missense Mutation TCG,TTG S,L 189 NP_056934.2
          NM_023105.2 413 Missense Mutation TCG,TTG S,L 102 NP_075593.1
          NM_023106.2 413 Missense Mutation TCG,TTG S,L 100 NP_075594.1
          NM_023110.2 413 Missense Mutation TCG,TTG S,L 191 NP_075598.2
          XM_006716303.2 413 Missense Mutation TCG,TTG S,L 191 XP_006716366.1
          XM_006716304.1 413 Missense Mutation TCG,TTG S,L 191 XP_006716367.1
          XM_006716306.2 413 Missense Mutation TCG,TTG S,L 189 XP_006716369.1
          XM_006716307.1 413 Missense Mutation TCG,TTG S,L 189 XP_006716370.1
          XM_006716309.3 413 Missense Mutation TCG,TTG S,L 183 XP_006716372.1
          XM_006716310.2 413 Missense Mutation TCG,TTG S,L 102 XP_006716373.1
          XM_006716311.1 413 Missense Mutation TCG,TTG S,L 102 XP_006716374.1
          XM_006716312.1 413 Missense Mutation TCG,TTG S,L 102 XP_006716375.1
          XM_006716313.2 413 Missense Mutation TCG,TTG S,L 100 XP_006716376.1
          XM_006716314.1 413 Missense Mutation TCG,TTG S,L 100 XP_006716377.1
          XM_011544443.2 413 Missense Mutation TCG,TTG S,L 224 XP_011542745.1
          XM_011544444.1 413 Missense Mutation TCG,TTG S,L 222 XP_011542746.1
          XM_011544445.2 413 Missense Mutation TCG,TTG S,L 224 XP_011542747.1
          XM_011544446.2 413 Missense Mutation TCG,TTG S,L 224 XP_011542748.1
          XM_011544447.2 413 Missense Mutation TCG,TTG S,L 224 XP_011542749.1
          XM_011544448.1 413 Missense Mutation TCG,TTG S,L 135 XP_011542750.1
          XM_011544449.1 413 Missense Mutation TCG,TTG S,L 133 XP_011542751.1
          XM_011544450.2 413 Missense Mutation TCG,TTG S,L 133 XP_011542752.1
          XM_011544451.1 413 Missense Mutation TCG,TTG S,L 94 XP_011542753.1
          XM_011544452.2 413 Missense Mutation TCG,TTG S,L 222 XP_011542754.1
          XM_017013219.1 413 Missense Mutation TCG,TTG S,L 222 XP_016868708.1
          XM_017013220.1 413 Missense Mutation TCG,TTG S,L 222 XP_016868709.1
          XM_017013221.1 413 Missense Mutation TCG,TTG S,L 191 XP_016868710.1
          XM_017013222.1 413 Missense Mutation TCG,TTG S,L 191 XP_016868711.1
          XM_017013223.1 413 Missense Mutation TCG,TTG S,L 189 XP_016868712.1
          XM_017013224.1 413 Missense Mutation TCG,TTG S,L 189 XP_016868713.1
          XM_017013225.1 413 Missense Mutation TCG,TTG S,L 189 XP_016868714.1
          XM_017013226.1 413 Missense Mutation TCG,TTG S,L 135 XP_016868715.1
          XM_017013227.1 413 Missense Mutation TCG,TTG S,L 133 XP_016868716.1
          XM_017013228.1 413 Missense Mutation TCG,TTG S,L 100 XP_016868717.1
          XM_017013229.1 413 Intron XP_016868718.1
          XM_017013230.1 413 UTR 5 XP_016868719.1
          XM_017013231.1 413 Missense Mutation TCG,TTG S,L 224 XP_016868720.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transmembrane signal receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          MAPK cascade
          skeletal system development
          angiogenesis
          ureteric bud development
          in utero embryonic development
          organ induction
          neuron migration
          positive regulation of mesenchymal cell proliferation
          chondrocyte differentiation
          transcription, DNA-templated
          protein phosphorylation
          sensory perception of sound
          positive regulation of cell proliferation
          fibroblast growth factor receptor signaling pathway
          positive regulation of phospholipase activity
          positive regulation of phospholipase C activity
          positive regulation of neuron projection development
          regulation of phosphatidylinositol 3-kinase signaling
          positive regulation of phosphatidylinositol 3-kinase signaling
          cell migration
          peptidyl-tyrosine phosphorylation
          stem cell population maintenance
          motogenic signaling involved in postnatal olfactory bulb interneuron migration
          ventricular zone neuroblast division
          embryonic limb morphogenesis
          midbrain development
          neuron projection development
          fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development
          phosphatidylinositol-3-phosphate biosynthetic process
          inner ear morphogenesis
          outer ear morphogenesis
          middle ear morphogenesis
          chordate embryonic development
          positive regulation of MAP kinase activity
          positive regulation of MAPK cascade
          positive regulation of GTPase activity
          regulation of cell differentiation
          positive regulation of neuron differentiation
          negative regulation of osteoblast differentiation
          positive regulation of cell cycle
          protein autophosphorylation
          phosphatidylinositol phosphorylation
          phosphatidylinositol-mediated signaling
          paraxial mesoderm development
          regulation of lateral mesodermal cell fate specification
          cell maturation
          skeletal system morphogenesis
          mesenchymal cell differentiation
          regulation of sensory perception of pain
          positive regulation of cardiac muscle cell proliferation
          auditory receptor cell development
          branching involved in salivary gland morphogenesis
          lung-associated mesenchyme development
          regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling
          regulation of stem cell proliferation
          positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway
          positive regulation of endothelial cell chemotaxis to fibroblast growth factor
          regulation of extrinsic apoptotic signaling pathway in absence of ligand
          glycoprotein binding
          protein tyrosine kinase activity
          fibroblast growth factor-activated receptor activity
          Ras guanyl-nucleotide exchange factor activity
          protein binding
          ATP binding
          heparin binding
          1-phosphatidylinositol-3-kinase activity
          fibroblast growth factor binding
          protein complex binding
          identical protein binding
          protein homodimerization activity
          phosphatidylinositol-4,5-bisphosphate 3-kinase activity
          cell adhesion molecule binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-knt4q:80/100.66.75.14:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0