Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_310752947_10
          See other POMT1 GT Assays ›
          SNP ID:
          rs587777817
          Gene
          POMT1 UCK1
          Gene Name
          protein O-mannosyltransferase 1
          uridine-cytidine kinase 1
          Set Membership:
          -
          Chromosome Location:
          Chr.9: 131522972 - 131522973 on Build GRCh38
          Polymorphism:
          -/G, Insertion/deletion
          Context Sequence [VIC/FAM]:

          AGCATCTTCAGCGCCCTGGTGGTGG[-/G]CCTGGTACTCCTCCGCGTGCCACGT

          Assay ID C_310752947_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 607423 MIM: 609328

          Literature Links:

          POMT1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          POMT1 - protein O-mannosyltransferase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001077365.1 2099 Frame Shift InDel GCC,GGC A,G 682 NP_001070833.1
          NM_001077366.1 2099 Frame Shift InDel GCC,GGC A,G 628 NP_001070834.1
          NM_001136113.1 2099 Frame Shift InDel GCC,GGC A,G 682 NP_001129585.1
          NM_001136114.1 2099 Frame Shift InDel GCC,GGC A,G 565 NP_001129586.1
          NM_007171.3 2099 Frame Shift InDel GCC,GGC A,G 704 NP_009102.3
          XM_005272156.1 2099 Frame Shift InDel GCC,GGC A,G 704 XP_005272213.1
          XM_005272158.1 2099 Frame Shift InDel GCC,GGC A,G 650 XP_005272215.1
          XM_005272159.1 2099 Frame Shift InDel GCC,GGC A,G 587 XP_005272216.1
          XM_005272162.2 2099 Frame Shift InDel GCC,GGC A,G 305 XP_005272219.1
          XM_006716932.1 2099 Frame Shift InDel GCC,GGC A,G 587 XP_006716995.1
          XM_011518140.1 2099 Frame Shift InDel GCC,GGC A,G 655 XP_011516442.1
          XM_011518141.1 2099 Frame Shift InDel GCC,GGC A,G 633 XP_011516443.1
          XM_011518142.1 2099 Frame Shift InDel GCC,GGC A,G 601 XP_011516444.1
          XM_011518143.1 2099 Frame Shift InDel GCC,GGC A,G 599 XP_011516445.1
          XM_011518145.1 2099 Frame Shift InDel GCC,GGC A,G 552 XP_011516447.1
          XM_017014203.1 2099 Frame Shift InDel GCC,GGC A,G 650 XP_016869692.1
          XM_017014204.1 2099 Frame Shift InDel GCC,GGC A,G 305 XP_016869693.1
          XM_017014205.1 2099 Frame Shift InDel GCC,GGC A,G 305 XP_016869694.1
          UCK1 - uridine-cytidine kinase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001135954.2 2099 Intron NP_001129426.1
          NM_001261450.2 2099 Intron NP_001248379.1
          NM_001261451.2 2099 Intron NP_001248380.1
          NM_001318519.1 2099 Intron NP_001305448.1
          NM_031432.3 2099 Intron NP_113620.1
          XM_005272224.2 2099 Intron XP_005272281.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transferase metabolite interconversion enzyme nucleotide kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          cell wall mannoprotein biosynthetic process
          carbohydrate metabolic process
          protein O-linked glycosylation
          multicellular organism development
          extracellular matrix organization
          protein O-linked mannosylation
          chain elongation of O-linked mannose residue
          regulation of endoplasmic reticulum unfolded protein response
          pyrimidine nucleobase metabolic process
          phosphorylation
          pyrimidine nucleoside salvage
          UMP salvage
          CTP salvage
          mannosyltransferase activity
          dolichyl-phosphate-mannose-protein mannosyltransferase activity
          metal ion binding
          uridine kinase activity
          ATP binding
          nucleoside kinase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline