Search
LOADING 
- SNP ID:
- rs761322112
- Gene
-
TRPM6 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.9: 74883812 - 74883812 on Build GRCh38
- Polymorphism:
- G/A, Transition substitution
- Context Sequence [VIC/FAM]:
TTGAGCTCAGGAGTTCAAGACTAGC[G/A]TGGGCAACATAGTAAGATTCCATCT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607009
|
||||||||||||||||||||
Literature Links: |
TRPM6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| TRPM6 - transient receptor potential cation channel subfamily M member 6 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001177310.1 | Intron | NP_001170781.1 | ||||
| NM_001177311.1 | Intron | NP_001170782.1 | ||||
| NM_017662.4 | Intron | NP_060132.3 | ||||
| XM_011518244.1 | Intron | XP_011516546.1 | ||||
| XM_011518245.1 | Intron | XP_011516547.1 | ||||
| XM_011518246.1 | Intron | XP_011516548.1 | ||||
| XM_011518247.1 | Intron | XP_011516549.1 | ||||
| XM_011518248.1 | Intron | XP_011516550.1 | ||||
| XM_011518249.1 | Intron | XP_011516551.1 | ||||
| XM_011518250.1 | Intron | XP_011516552.1 | ||||
| XM_011518251.2 | Intron | XP_011516553.1 | ||||
| XM_011518252.2 | Intron | XP_011516554.1 | ||||
| XM_011518255.2 | Intron | XP_011516557.1 | ||||
| XM_017014287.1 | Intron | XP_016869776.1 | ||||
| XM_017014288.1 | Intron | XP_016869777.1 | ||||
| XM_017014289.1 | Intron | XP_016869778.1 | ||||
Back To Top