Search
Search

CTNNAL1
FAM206A
IKBKAPCAAGGATGGAGGCGCCCTCCAGGGG[A/C]AAACGCTGAAGCGCTGCAAAGAAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
CTNNAL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| CTNNAL1 - catenin alpha like 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| FAM206A - family with sequence similarity 206 member A | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_017832.3 | 283 | Intron | NP_060302.1 | |||
| XM_011518816.2 | 283 | Intron | XP_011517118.1 | |||
| IKBKAP - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001318360.1 | 283 | UTR 5 | NP_001305289.1 | |||
| NM_003640.4 | 283 | UTR 5 | NP_003631.2 | |||
| XM_011519136.1 | 283 | UTR 5 | XP_011517438.1 | |||
| XM_011519137.1 | 283 | Intron | XP_011517439.1 | |||
| XM_017015238.1 | 283 | UTR 5 | XP_016870727.1 | |||