Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_312000196_10
          See other DPP7 GT Assays ›
          SNP ID:
          rs776190056
          Gene
          DPP7 LOC101930307 MAN1B1
          Gene Name
          dipeptidyl peptidase 7
          uncharacterized LOC101930307
          mannosidase alpha class 1B member 1
          Set Membership:
          -
          Chromosome Location:
          Chr.9: 137105600 - 137105600 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          CATCCCGGTACCCTGTGCCCCTCTG[T/C]GGGCCAGGACGCCTGGTGCTGCCAG

          Assay ID C_312000196_10
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610537 MIM: 604346

          Literature Links:

          DPP7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          DPP7 - dipeptidyl peptidase 7
          There are no transcripts associated with this gene.
          LOC101930307 - uncharacterized LOC101930307
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          XM_017015415.1 Intron XP_016870904.1
          XM_017015416.1 Intron XP_016870905.1
          XM_017015417.1 Intron XP_016870906.1
          XM_017015418.1 Intron XP_016870907.1
          XM_017015419.1 Intron XP_016870908.1
          XM_017015420.1 Intron XP_016870909.1
          XM_017015421.1 Intron XP_016870910.1
          XM_017015422.1 Intron XP_016870911.1
          XM_017015423.1 Intron XP_016870912.1
          XM_017015424.1 Intron XP_016870913.1
          XM_017015425.1 Intron XP_016870914.1
          XM_017015426.1 Intron XP_016870915.1
          XM_017015427.1 Intron XP_016870916.1
          XM_017015428.1 Intron XP_016870917.1
          XM_017015429.1 Intron XP_016870918.1
          XM_017015430.1 Intron XP_016870919.1
          XM_017015431.1 Intron XP_016870920.1
          XM_017015432.1 Intron XP_016870921.1
          XM_017015433.1 Intron XP_016870922.1
          XM_017015434.1 Intron XP_016870923.1
          XM_017015435.1 Intron XP_016870924.1
          XM_017015436.1 Intron XP_016870925.1
          XM_017015437.1 Intron XP_016870926.1
          XM_017015438.1 Intron XP_016870927.1
          XM_017015439.1 Intron XP_016870928.1
          XM_017015440.1 Intron XP_016870929.1
          XM_017015441.1 Intron XP_016870930.1
          XM_017015442.1 Intron XP_016870931.1
          XM_017015443.1 Intron XP_016870932.1
          XM_017015444.1 Intron XP_016870933.1
          XM_017015445.1 Intron XP_016870934.1
          XM_017015446.1 Intron XP_016870935.1
          XM_017015447.1 Intron XP_016870936.1
          XM_017015448.1 Intron XP_016870937.1
          XM_017015449.1 Intron XP_016870938.1
          XM_017015450.1 Intron XP_016870939.1
          XM_017015451.1 Intron XP_016870940.1
          XM_017015452.1 Intron XP_016870941.1
          XM_017015453.1 Intron XP_016870942.1
          XM_017015454.1 Intron XP_016870943.1
          XM_017015455.1 Intron XP_016870944.1
          XM_017015456.1 Intron XP_016870945.1
          XM_017015457.1 Intron XP_016870946.1
          MAN1B1 - mannosidase alpha class 1B member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_016219.4 Intron NP_057303.2
          XM_006716945.3 Intron XP_006717008.1
          XM_017014239.1 Intron XP_016869728.1

          Back To Top

          추가 정보


          Panther Classification:

          Molecular Function -

          protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          N-glycan processing
          oligosaccharide metabolic process
          ER-associated ubiquitin-dependent protein catabolic process
          protein alpha-1,2-demannosylation
          trimming of terminal mannose on B branch
          endoplasmic reticulum mannose trimming
          mannose trimming involved in glycoprotein ERAD pathway
          alpha-mannosidase activity
          mannosyl-oligosaccharide 1,2-alpha-mannosidase activity
          calcium ion binding

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline