Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_319404981_10
          See other MAP4K2 GT Assays ›
          SNP ID:
          rs566593066
          Gene
          MAP4K2 MEN1
          Gene Name
          mitogen-activated protein kinase kinase kinase kinase 2
          menin 1
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 64805655 - 64805655 on Build GRCh38
          Polymorphism:
          G/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          TTCACCTGGCTTTGCTCCCCCGGCC[G/C]CTCCTCGCCCGCCTCCAGCAAGCTG

          Assay ID C_319404981_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603166 MIM: 613733

          Literature Links:

          MAP4K2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          MAP4K2 - mitogen-activated protein kinase kinase kinase kinase 2
          There are no transcripts associated with this gene.
          MEN1 - menin 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000244.3 1657 Missense Mutation CGG,GGG R,G 394 NP_000235.2
          NM_130799.2 1657 Missense Mutation CGG,GGG R,G 389 NP_570711.1
          NM_130800.2 1657 Missense Mutation CGG,GGG R,G 394 NP_570712.1
          NM_130801.2 1657 Missense Mutation CGG,GGG R,G 394 NP_570713.1
          NM_130802.2 1657 Missense Mutation CGG,GGG R,G 394 NP_570714.1
          NM_130803.2 1657 Missense Mutation CGG,GGG R,G 394 NP_570715.1
          NM_130804.2 1657 Missense Mutation CGG,GGG R,G 394 NP_570716.1
          XM_005274001.4 1657 Missense Mutation CGG,GGG R,G 389 XP_005274058.1
          XM_011545040.1 1657 Missense Mutation CGG,GGG R,G 431 XP_011543342.1
          XM_011545041.2 1657 Missense Mutation CGG,GGG R,G 431 XP_011543343.1
          XM_011545042.2 1657 Missense Mutation CGG,GGG R,G 431 XP_011543344.1
          XM_017017765.1 1657 Missense Mutation CGG,GGG R,G 436 XP_016873254.1
          XM_017017766.1 1657 Missense Mutation CGG,GGG R,G 436 XP_016873255.1
          XM_017017767.1 1657 Missense Mutation CGG,GGG R,G 436 XP_016873256.1
          XM_017017768.1 1657 Missense Mutation CGG,GGG R,G 436 XP_016873257.1
          XM_017017769.1 1657 Missense Mutation CGG,GGG R,G 389 XP_016873258.1
          XM_017017770.1 1657 Missense Mutation CGG,GGG R,G 389 XP_016873259.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          MAPK cascade
          mitotic cell cycle
          negative regulation of protein phosphorylation
          osteoblast development
          type B pancreatic cell differentiation
          DNA repair
          transcription, DNA-templated
          cellular response to DNA damage stimulus
          brain development
          negative regulation of cell proliferation
          response to UV
          response to gamma radiation
          negative regulation of cell-substrate adhesion
          positive regulation of transforming growth factor beta receptor signaling pathway
          positive regulation of protein binding
          regulation of activin receptor signaling pathway
          histone lysine methylation
          negative regulation of sequence-specific DNA binding transcription factor activity
          negative regulation of osteoblast differentiation
          negative regulation of cyclin-dependent protein serine/threonine kinase activity
          negative regulation of cell cycle
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of JNK cascade
          decidualization
          negative regulation of epithelial cell proliferation
          negative regulation of telomerase activity
          regulation of type B pancreatic cell proliferation
          cellular response to glucose stimulus
          cellular response to peptide hormone stimulus
          response to transforming growth factor beta
          negative regulation of cell cycle G1/S phase transition
          beta-catenin-TCF complex assembly
          four-way junction DNA binding
          Y-form DNA binding
          chromatin binding
          double-stranded DNA binding
          protein binding
          histone-lysine N-methyltransferase activity
          protein binding, bridging
          transcription regulatory region DNA binding
          protein N-terminus binding
          R-SMAD binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline