Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_320987651_10
          See other TRAF6 GT Assays ›
          SNP ID:
          rs763953424
          Gene
          TRAF6
          Gene Name
          TNF receptor associated factor 6
          Set Membership:
          -
          Chromosome Location:
          Chr.11: 36489227 - 36489227 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ATGTTTACACTAAATAATTAAGGTT[A/G]TATTTAGGGTTTAAACTCATCCCTG

          Assay ID C_320987651_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602355

          Literature Links:

          TRAF6 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          TRAF6 - TNF receptor associated factor 6
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_004620.3 2468 UTR 3 NP_004611.1
          NM_145803.2 2468 UTR 3 NP_665802.1
          XM_017018220.1 2468 Intron XP_016873709.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          scaffold/adaptor protein

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          activation of MAPK activity
          protein polyubiquitination
          ossification
          neural tube closure
          stimulatory C-type lectin receptor signaling pathway
          toll-like receptor signaling pathway
          positive regulation of T cell cytokine production
          MyD88-dependent toll-like receptor signaling pathway
          MyD88-independent toll-like receptor signaling pathway
          protein complex assembly
          I-kappaB kinase/NF-kappaB signaling
          activation of NF-kappaB-inducing kinase activity
          JNK cascade
          antigen processing and presentation of exogenous peptide antigen via MHC class II
          osteoclast differentiation
          membrane protein intracellular domain proteolysis
          positive regulation of protein ubiquitination
          positive regulation of lipopolysaccharide-mediated signaling pathway
          activation of protein kinase activity
          positive regulation of interleukin-2 production
          toll-like receptor 9 signaling pathway
          Fc-epsilon receptor signaling pathway
          T-helper 1 type immune response
          positive regulation of T cell proliferation
          odontogenesis of dentin-containing tooth
          myeloid dendritic cell differentiation
          positive regulation of apoptotic process
          negative regulation of apoptotic process
          positive regulation of I-kappaB kinase/NF-kappaB signaling
          positive regulation of JUN kinase activity
          positive regulation of interleukin-12 biosynthetic process
          positive regulation of interleukin-6 biosynthetic process
          bone resorption
          positive regulation of osteoclast differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          cell development
          positive regulation of smooth muscle cell proliferation
          T cell receptor signaling pathway
          positive regulation of T cell activation
          regulation of immunoglobulin secretion
          positive regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of NF-kappaB transcription factor activity
          protein autoubiquitination
          nucleotide-binding oligomerization domain containing signaling pathway
          interleukin-1-mediated signaling pathway
          protein K63-linked ubiquitination
          response to interleukin-1
          cellular response to lipopolysaccharide
          positive regulation of transcription regulatory region DNA binding
          ubiquitin-protein transferase activity
          tumor necrosis factor receptor binding
          protein binding
          zinc ion binding
          ligase activity
          protein kinase binding
          mitogen-activated protein kinase kinase kinase binding
          ubiquitin conjugating enzyme binding
          ubiquitin protein ligase binding
          thioesterase binding
          identical protein binding
          histone deacetylase binding
          protein kinase B binding
          protein N-terminus binding
          ubiquitin protein ligase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline