Search
Search

CASC1
KRAS
LYRM5CAAATAATAAAAGTTCCAGGAAGGG[A/G]GAAAAAAGAAAATGGAGGAGGGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
CASC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| CASC1 - cancer susceptibility candidate 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| KRAS - KRAS proto-oncogene, GTPase | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| LYRM5 - LYR motif containing 5 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001001660.2 | Intron | NP_001001660.2 | ||||
| XM_005253319.4 | Intron | XP_005253376.1 | ||||
| XM_005253320.4 | Intron | XP_005253377.1 | ||||
| XM_017018850.1 | Intron | XP_016874339.1 | ||||