Search
LOADING 
- SNP ID:
- rs750827196
- Gene
-
DIO3DIO3OSMIR1247 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.14: 101562569 - 101562569 on Build GRCh38
- Polymorphism:
- G/C, Transversion substitution
- Context Sequence [VIC/FAM]:
ACTGAGTCTGCACCCTCAGCCACAT[G/C]AACAATCTCCCCTACCTCCCTGGGA
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601038
MIM: 608523
|
||||||||||||||||||||
Literature Links: |
DIO3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| DIO3 - deiodinase, iodothyronine, type III | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001362.3 | 1219 | UTR 3 | NP_001353.4 | |||
| DIO3OS - DIO3 opposite strand/antisense RNA (head to head) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| MIR1247 - microRNA 1247 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top