Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Productos
    • Anticuerpos
    • Oligonucleótidos, cebadores, sondas y genes
    • Ensayos de PCR en tiempo real TaqMan
    • Medios de cultivos celulares
    • Productos químicos
    • Columnas y cartuchos de cromatografía
    • Equipo de laboratorio
    • Material de plástico y suministros para laboratorio
    • Microplacas
    • Productos más ecológicos
    • Ver todas las categorías de productos
  • Applications
    • Bioprocesamiento
    • Cultivo celular y transfección
    • Terapia celular y génica
    • Cromatografía
    • Pruebas moleculares
    • Soluciones digitales
    • Extracción y análisis de ADN y ARN
    • Espectroscopía, análisis elemental y de isótopos
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Servicios personalizados
    • Servicios de leasing y financiación
    • Servicios de instrumentos
    • Informática de laboratorio
    • OEM y oferta comercial
    • Servicios de formación
    • Unity Lab Services
    • Ver todos los servicios
  • Ayuda y soporte técnico
    • Regístrese para obtener una cuenta
    • Cómo hacer un pedido
    • Asistencia para el instrumental
    • Centros de soporte técnico
    • Centros de formación
    • Vea todos los temas de ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Promociones
  • Contacto
  • Pedido rápido
  • Estado del pedido y seguimiento
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Estado del pedido
          • Pedido rápido
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Cuenta
            • Pedidos
            • Connect: laboratorio, datos, aplicaciones
            • Productos y proyectos personalizados
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_332846599_10
          See other DHRS2 GT Assays ›
          SNP ID:
          rs771305549
          Gene
          DHRS2
          Gene Name
          dehydrogenase/reductase 2
          Set Membership:
          -
          Chromosome Location:
          Chr.14: 23635487 - 23635487 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          ACACATGACCTCCTGTCTGCAGGAT[G/T]CAAGTTCCCTCTACAGAGTCAGAGA

          Assay ID C_332846599_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 615194

          Literature Links:

          DHRS2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          DHRS2 - dehydrogenase/reductase 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001318835.1 Intron NP_001305764.1
          NM_005794.3 Intron NP_005785.1
          NM_182908.4 Intron NP_878912.1
          XM_005267249.1 Intron XP_005267306.1
          XM_006720001.3 Intron XP_006720064.1
          XM_011536338.1 Intron XP_011534640.1
          XM_011536339.2 Intron XP_011534641.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          dehydrogenase

          Gene Ontology Categories:

          Function(s) Process(es)

          C21-steroid hormone metabolic process
          negative regulation of cell proliferation
          response to toxic substance
          cellular response to oxidative stress
          myeloid dendritic cell differentiation
          negative regulation of apoptotic process
          oxidation-reduction process
          carbonyl reductase (NADPH) activity
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estado del pedido
          • Ayuda con el pedido
          • Pedido rápido
          • Centro de suministros
          • eProcurement (B2B)
          Asistencia Plus Icon Minus Icon
          • Ayuda y soporte técnico
          • Contacto
          • Centros de soporte técnico
          • Documentos y certificados
          • Informar de un problema del sitio web
          Recursos Plus Icon Minus Icon
          • Centros de formación
          • Promociones
          • Eventos y seminarios web
          • Redes sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Carreras profesionales Carreras profesionales
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas registradas
          • Políticas y avisos
          Nuestra cartera Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline