Hamburger Menu Button
Thermo Fisher Scientific Logo
登入
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Tubes
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Clinical Genomics
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO 和 CRO 服務
    • CDMO 服務
    • 臨床試驗 CRO 服務
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Register for an Account
    • How to Order
    • Instrument Support
    • Technical Support Centers
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • 快速訂購
          • 登入
            登入
            Don't have an account ? Create Account
            • 帳戶
            • 訂單
            • 訂製產品與專案
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_336300945_10
          See other ADAL GT Assays ›
          SNP ID:
          rs773946552
          Gene
          ADAL LCMT2
          Gene Name
          adenosine deaminase like
          leucine carboxyl methyltransferase 2
          Set Membership:
          -
          Chromosome Location:
          Chr.15: 43340299 - 43340299 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          GATGTCATAAAAGAATTTGCAGATG[A/T]CGGCGTCAAGTACCTGGAACTAAGG

          Assay ID C_336300945_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611246

          Literature Links:

          ADAL PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ADAL - adenosine deaminase like
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001012969.3 432 Missense Mutation GAC,GTC D,V 97 NP_001012987.1
          NM_001159280.2 432 Missense Mutation GAC,GTC D,V 97 NP_001152752.1
          NM_001324364.1 432 Missense Mutation GAC,GTC D,V 97 NP_001311293.1
          NM_001324365.1 432 Missense Mutation GAC,GTC D,V 97 NP_001311294.1
          NM_001324366.1 432 Missense Mutation GAC,GTC D,V 97 NP_001311295.1
          NM_001324367.1 432 Missense Mutation GAC,GTC D,V 97 NP_001311296.1
          NM_001324368.1 432 Missense Mutation GAC,GTC D,V 97 NP_001311297.1
          XM_011521291.2 432 Missense Mutation GAC,GTC D,V 97 XP_011519593.1
          XM_017021964.1 432 Missense Mutation GAC,GTC D,V 97 XP_016877453.1
          XM_017021965.1 432 Missense Mutation GAC,GTC D,V 97 XP_016877454.1
          XM_017021966.1 432 Missense Mutation GAC,GTC D,V 97 XP_016877455.1
          XM_017021967.1 432 Missense Mutation GAC,GTC D,V 62 XP_016877456.1
          XM_017021968.1 432 Missense Mutation GAC,GTC D,V 97 XP_016877457.1
          XM_017021969.1 432 Missense Mutation GAC,GTC D,V 97 XP_016877458.1
          LCMT2 - leucine carboxyl methyltransferase 2
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          deaminase

          Gene Ontology Categories:

          Function(s) Process(es)

          adenosine catabolic process
          nucleotide metabolic process
          drug metabolic process
          purine-containing compound salvage
          hypoxanthine salvage
          inosine biosynthetic process
          adenosine deaminase activity
          metal ion binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Hong Kong flag icon
          Hong Kong

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline