Search
LOADING 
- SNP ID:
- rs541991079
- Gene
-
ADGRG5CCDC102A - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.16: 57527358 - 57527358 on Build GRCh38
- Polymorphism:
- G/A, Transition substitution
- Context Sequence [VIC/FAM]:
CCTGATTATTACCCTGGACTCTGGA[G/A]CCAGATTGTCCAGGTTCAAACCCCA
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616965
|
||||||||||||||||||||
Literature Links: |
ADGRG5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| ADGRG5 - adhesion G protein-coupled receptor G5 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| CCDC102A - coiled-coil domain containing 102A | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_033212.3 | Intron | NP_149989.2 | ||||
| XM_011523469.2 | Intron | XP_011521771.1 | ||||
Back To Top