Search

  • Contáctenos
  • Orden Rápida

System Message

OKCancel
LOADING ...
See other PRMT7 GT Assays ›
SNP ID:
rs777623045
Gene
PRMT7 SLC7A6 SLC7A6OS
Gene Name
Set Membership:
-
Chromosome Location:
Chr.16: 68311045 - 68311045 on Build GRCh38
Polymorphism:
C/T, Transition substitution
Context Sequence [VIC/FAM]:

ACGCTGCGAGGTCCCGCCCCGCGTG[C/T]TGGCCGCGGTAAAAGTGGTAGCAGC

Assay ID C_339455003_10
Size
Availability Made To Order
Catalog # 4351379
Price
Your Price
Online offer:
Check your price ›

Assay Details



Species:

 Human

dbSNP Submissions:

 NA

Phenotype:

 MIM: 610087 MIM: 605641

Literature Links:

 PRMT7 PubMed Links

Allele Nomenclature:

Minor Allele Frequency:
1000Genome Applied Biosystems® HapMap
Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available
PRMT7 - protein arginine methyltransferase 7
Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
NM_001184824.1 4 UTR 5 NP_001171753.1
NM_001290018.1 4 Intron NP_001276947.1
NM_019023.2 4 UTR 5 NP_061896.1
XM_011523112.2 4 UTR 5 XP_011521414.1
XM_011523113.2 4 UTR 5 XP_011521415.1
XM_011523115.2 4 UTR 5 XP_011521417.1
XM_011523116.2 4 UTR 5 XP_011521418.1
XM_011523121.2 4 Intron XP_011521423.1
XM_011523124.2 4 UTR 5 XP_011521426.1
XM_011523125.2 4 UTR 5 XP_011521427.1
XM_011523126.2 4 Intron XP_011521428.1
XM_011523128.2 4 Intron XP_011521430.1
XM_011523131.2 4 Intron XP_011521433.1
XM_017023290.1 4 UTR 5 XP_016878779.1
XM_017023291.1 4 Intron XP_016878780.1
XM_017023292.1 4 UTR 5 XP_016878781.1
XM_017023293.1 4 UTR 5 XP_016878782.1
XM_017023294.1 4 Intron XP_016878783.1
XM_017023295.1 4 UTR 5 XP_016878784.1
XM_017023296.1 4 UTR 5 XP_016878785.1
XM_017023297.1 4 UTR 5 XP_016878786.1
XM_017023298.1 4 UTR 5 XP_016878787.1
XM_017023299.1 4 UTR 5 XP_016878788.1
XM_017023300.1 4 UTR 5 XP_016878789.1
XM_017023301.1 4 UTR 5 XP_016878790.1
XM_017023302.1 4 UTR 5 XP_016878791.1
XM_017023303.1 4 UTR 5 XP_016878792.1
XM_017023304.1 4 UTR 5 XP_016878793.1
XM_017023305.1 4 Intron XP_016878794.1
XM_017023306.1 4 UTR 5 XP_016878795.1
XM_017023307.1 4 UTR 5 XP_016878796.1
XM_017023308.1 4 UTR 5 XP_016878797.1
XM_017023309.1 4 UTR 5 XP_016878798.1
XM_017023310.1 4 UTR 5 XP_016878799.1
XM_017023311.1 4 UTR 5 XP_016878800.1
XM_017023312.1 4 UTR 5 XP_016878801.1
XM_017023313.1 4 UTR 5 XP_016878802.1
XM_017023314.1 4 Intron XP_016878803.1
XM_017023315.1 4 UTR 5 XP_016878804.1
XM_017023316.1 4 Intron XP_016878805.1
SLC7A6 - solute carrier family 7 member 6
There are no transcripts associated with this gene.
SLC7A6OS - solute carrier family 7 member 6 opposite strand
Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
NM_032178.2 4 Intron NP_115554.2
XM_011523372.2 4 Intron XP_011521674.1

Back To Top

Related Products