Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_345295071_10
          See other ADCYAP1 GT Assays ›
          SNP ID:
          rs778661714
          Gene
          ADCYAP1
          Gene Name
          adenylate cyclase activating polypeptide 1
          Set Membership:
          -
          Chromosome Location:
          Chr.18: 905141 - 905141 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CGCTTGGCATCGCGTCAGGGGAGTT[A/G]GCTTTCCTTCAGCCGGGTCTGGCTA

          Assay ID C_345295071_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 102980

          Literature Links:

          ADCYAP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ADCYAP1 - adenylate cyclase activating polypeptide 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001099733.1 Intron NP_001093203.1
          NM_001117.4 Intron NP_001108.2
          XM_005258081.3 Intron XP_005258138.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          neuropeptide

          Gene Ontology Categories:

          Function(s) Process(es)

          ovarian follicle development
          behavioral fear response
          histamine secretion
          negative regulation of acute inflammatory response to antigenic stimulus
          negative regulation of acute inflammatory response to non-antigenic stimulus
          activation of adenylate cyclase activity
          positive regulation of cytosolic calcium ion concentration
          neuropeptide signaling pathway
          cell-cell signaling
          female pregnancy
          regulation of G-protein coupled receptor protein signaling pathway
          positive regulation of cell proliferation
          positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway
          negative regulation of muscle cell apoptotic process
          positive regulation of neuron projection development
          sensory perception of pain
          cAMP-mediated signaling
          pituitary gland development
          neuron projection development
          positive regulation of interleukin-6 production
          regulation of protein localization
          negative regulation of GTPase activity
          response to starvation
          negative regulation of potassium ion transport
          positive regulation of GTPase activity
          response to ethanol
          negative regulation of cell cycle
          positive regulation of protein kinase activity
          positive regulation of vasodilation
          positive regulation of transcription from RNA polymerase II promoter
          ATP metabolic process
          positive regulation of synaptic transmission, glutamatergic
          regulation of postsynaptic membrane potential
          positive regulation of growth hormone secretion
          negative regulation of glial cell proliferation
          positive regulation of ERK1 and ERK2 cascade
          regulation of oligodendrocyte progenitor proliferation
          cellular response to glucocorticoid stimulus
          positive regulation of chemokine (C-C motif) ligand 5 production
          positive regulation of somatostatin secretion
          receptor signaling protein activity
          receptor binding
          neuropeptide hormone activity
          protein binding
          pituitary adenylate cyclase activating polypeptide activity
          pituitary adenylate cyclase-activating polypeptide receptor binding
          peptide hormone receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline