Search
LOADING 
- SNP ID:
- rs750038808
- Gene
-
C19orf38DNM2MIR6793TMED1 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.19: 10836682 - 10836682 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
AAAGGGCTGGGGCGGGGCGGAGATA[C/T]CTGTGGCGTCGTGTTTTGCTTGCTC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602378
MIM: 605395
|
||||||||||||||||||||
Literature Links: |
C19orf38 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| C19orf38 - chromosome 19 open reading frame 38 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001136482.1 | 111 | Intron | NP_001129954.1 | |||
| XM_005259846.4 | 111 | UTR 5 | XP_005259903.1 | |||
| XM_005259847.4 | 111 | UTR 5 | XP_005259904.1 | |||
| DNM2 - dynamin 2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| MIR6793 - microRNA 6793 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| TMED1 - transmembrane p24 trafficking protein 1 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_006858.3 | 111 | Intron | NP_006849.1 | |||
| XM_006722631.3 | 111 | Intron | XP_006722694.1 | |||
Back To Top