Search
Search

CLASRP
GEMIN7
ZNF296CCCCCATTACCGACATTAGGCAGAA[G/C]AGTGGGGGGTGGGGAGGACAAGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
CLASRP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| CLASRP - CLK4 associating serine/arginine rich protein | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001278439.1 | 2130 | UTR 3 | NP_001265368.1 | |||
| NM_007056.2 | 2130 | UTR 3 | NP_008987.2 | |||
| XM_011526396.2 | 2130 | UTR 3 | XP_011524698.1 | |||
| XM_011526397.2 | 2130 | UTR 3 | XP_011524699.1 | |||
| GEMIN7 - gem nuclear organelle associated protein 7 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| ZNF296 - zinc finger protein 296 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||