Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_348016229_10
          See other CBARP GT Assays ›
          SNP ID:
          rs864622091
          Gene
          CBARP STK11
          Gene Name
          CACN beta subunit associated regulatory protein
          serine/threonine kinase 11
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 1226609 - 1226610 on Build GRCh38
          Polymorphism:
          AG/CC, Multiple nucleotide polymorphism
          Context Sequence [VIC/FAM]:

          GCCCGCAAGGCCTGCTCCGCCAGC[AG/CC]CAAGATCCGCCGGCTGTCGGCCTG

          Assay ID C_348016229_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602216

          Literature Links:

          CBARP PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CBARP - CACN beta subunit associated regulatory protein
          There are no transcripts associated with this gene.
          STK11 - serine/threonine kinase 11
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000455.4 2015 Missense Mutation NP_000446.1
          XM_005259617.2 2015 Silent Mutation XP_005259674.1
          XM_005259618.3 2015 Intron XP_005259675.1
          XM_011528209.1 2015 Silent Mutation XP_011526511.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          regulation of cell growth
          tissue homeostasis
          vasculature development
          protein phosphorylation
          autophagy
          cellular response to DNA damage stimulus
          cell cycle arrest
          spermatid development
          axonogenesis
          negative regulation of cell proliferation
          response to ionizing radiation
          positive regulation of autophagy
          establishment of cell polarity
          regulation of Wnt signaling pathway
          negative regulation of cell growth
          positive regulation of transforming growth factor beta receptor signaling pathway
          activation of protein kinase activity
          TCR signalosome assembly
          glucose homeostasis
          anoikis
          positive thymic T cell selection
          protein autophosphorylation
          regulation of dendrite morphogenesis
          positive regulation of peptidyl-tyrosine phosphorylation
          positive regulation of axonogenesis
          T cell receptor signaling pathway
          negative regulation of lipid biosynthetic process
          Golgi localization
          regulation of protein kinase B signaling
          canonical Wnt signaling pathway
          negative regulation of epithelial cell proliferation involved in prostate gland development
          cellular response to UV-B
          positive regulation of protein serine/threonine kinase activity
          intrinsic apoptotic signaling pathway by p53 class mediator
          dendrite extension
          positive regulation of protein localization to nucleus
          regulation of signal transduction by p53 class mediator
          negative regulation of TORC1 signaling
          magnesium ion binding
          p53 binding
          protein serine/threonine kinase activity
          protein binding
          ATP binding
          LRR domain binding
          protein kinase activator activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline