Search
Search

TSPEAR
TSPEAR-AS1
TSPEAR-AS2ACGCAGCTGGCCAGGTACGCT[CTGGGGCA/-]CTGGGGCATCTTGAGCACCTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
TSPEAR PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| TSPEAR - thrombospondin type laminin G domain and EAR repeats | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001272037.1 | Intron | NP_001258966.1 | ||||
| NM_144991.2 | Intron | NP_659428.2 | ||||
| TSPEAR-AS1 - TSPEAR antisense RNA 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| TSPEAR-AS2 - TSPEAR antisense RNA 2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||