Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_352817173_10
          See other BAIAP2L2 GT Assays ›
          SNP ID:
          rs866066890
          Gene
          BAIAP2L2 PLA2G6
          Gene Name
          BAI1 associated protein 2 like 2
          phospholipase A2 group VI
          Set Membership:
          -
          Chromosome Location:
          Chr.22: 38111613 - 38111613 on Build GRCh38
          Polymorphism:
          G/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          GGGTTCTCGGGGTGGGGCAGTGTGA[G/C]GGGCTGGGCCAGTGTGAGGGGCAAA

          Assay ID C_352817173_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603604

          Literature Links:

          BAIAP2L2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          BAIAP2L2 - BAI1 associated protein 2 like 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_025045.5 3154 Intron NP_079321.3
          XM_005261751.4 3154 Intron XP_005261808.1
          XM_011530379.2 3154 Intron XP_011528681.1
          XM_011530380.2 3154 Intron XP_011528682.1
          XM_011530381.2 3154 Intron XP_011528683.1
          XM_011530382.2 3154 Intron XP_011528684.1
          XM_011530383.2 3154 Intron XP_011528685.1
          XM_011530384.2 3154 Intron XP_011528686.1
          XM_011530386.2 3154 Intron XP_011528688.1
          XM_011530387.2 3154 Intron XP_011528689.1
          XM_011530388.2 3154 Intron XP_011528690.1
          PLA2G6 - phospholipase A2 group VI
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001004426.1 3154 UTR 3 NP_001004426.1
          NM_001199562.1 3154 UTR 3 NP_001186491.1
          NM_003560.2 3154 UTR 3 NP_003551.2
          XM_005261764.2 3154 UTR 3 XP_005261821.1
          XM_005261765.1 3154 UTR 3 XP_005261822.1
          XM_005261766.1 3154 UTR 3 XP_005261823.1
          XM_006724332.3 3154 UTR 3 XP_006724395.1
          XM_011530422.1 3154 UTR 3 XP_011528724.1
          XM_011530423.1 3154 UTR 3 XP_011528725.1
          XM_011530424.1 3154 UTR 3 XP_011528726.1
          XM_011530425.1 3154 UTR 3 XP_011528727.1
          XM_011530426.2 3154 Intron XP_011528728.1
          XM_017028981.1 3154 UTR 3 XP_016884470.1
          XM_017028982.1 3154 UTR 3 XP_016884471.1
          XM_017028983.1 3154 UTR 3 XP_016884472.1
          XM_017028984.1 3154 UTR 3 XP_016884473.1
          XM_017028985.1 3154 UTR 3 XP_016884474.1
          XM_017028986.1 3154 Intron XP_016884475.1
          XM_017028987.1 3154 Intron XP_016884476.1
          XM_017028988.1 3154 Intron XP_016884477.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          scaffold/adaptor protein phospholipase

          Gene Ontology Categories:

          Function(s) Process(es)

          plasma membrane organization
          insulin receptor signaling pathway
          positive regulation of actin filament polymerization
          actin filament bundle assembly
          actin crosslink formation
          membrane organization
          positive regulation of actin cytoskeleton reorganization
          positive regulation of protein phosphorylation
          chemotaxis
          positive regulation of cytosolic calcium ion concentration
          memory
          urinary bladder smooth muscle contraction
          lipid catabolic process
          antibacterial humoral response
          cardiolipin biosynthetic process
          response to endoplasmic reticulum stress
          positive regulation of insulin secretion involved in cellular response to glucose stimulus
          phosphatidylcholine acyl-chain remodeling
          phosphatidylethanolamine acyl-chain remodeling
          Fc-gamma receptor signaling pathway involved in phagocytosis
          positive regulation of vasodilation
          positive regulation of exocytosis
          negative regulation of synaptic transmission, glutamatergic
          maternal process involved in female pregnancy
          positive regulation of protein kinase C signaling
          positive regulation of release of cytochrome c from mitochondria
          positive regulation of arachidonic acid secretion
          regulation of store-operated calcium channel activity
          positive regulation of ceramide biosynthetic process
          phospholipid binding
          cytoskeletal adaptor activity
          phospholipase A2 activity
          calmodulin binding
          hydrolase activity
          protein kinase binding
          ATP-dependent protein binding
          calcium-independent phospholipase A2 activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-9kpsn:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0