Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_353822832_10
          See other KDM6A GT Assays ›
          SNP ID:
          rs745858790
          Gene
          KDM6A
          Gene Name
          lysine demethylase 6A
          Set Membership:
          -
          Chromosome Location:
          Chr.X: 45023625 - 45023625 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GATTGATATAAAGGTGAATATATGT[G/A]TGTGTTTGTTTTTATATGTGTGTAG

          Assay ID C_353822832_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 300128

          Literature Links:

          KDM6A PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          KDM6A - lysine demethylase 6A
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001291415.1 Intron NP_001278344.1
          NM_001291416.1 Intron NP_001278345.1
          NM_001291417.1 Intron NP_001278346.1
          NM_001291418.1 Intron NP_001278347.1
          NM_001291421.1 Intron NP_001278350.1
          NM_021140.3 Intron NP_066963.2
          XM_005272656.4 Intron XP_005272713.1
          XM_005272659.4 Intron XP_005272716.1
          XM_011543957.2 Intron XP_011542259.1
          XM_011543958.2 Intron XP_011542260.1
          XM_011543959.2 Intron XP_011542261.1
          XM_011543960.2 Intron XP_011542262.1
          XM_011543961.2 Intron XP_011542263.1
          XM_011543962.2 Intron XP_011542264.1
          XM_011543963.2 Intron XP_011542265.1
          XM_011543964.2 Intron XP_011542266.1
          XM_011543965.2 Intron XP_011542267.1
          XM_011543966.2 Intron XP_011542268.1
          XM_011543967.2 Intron XP_011542269.1
          XM_011543968.2 Intron XP_011542270.1
          XM_011543969.2 Intron XP_011542271.1
          XM_011543970.2 Intron XP_011542272.1
          XM_011543971.2 Intron XP_011542273.1
          XM_011543972.2 Intron XP_011542274.1
          XM_011543973.2 Intron XP_011542275.1
          XM_011543974.1 Intron XP_011542276.1
          XM_011543975.2 Intron XP_011542277.1
          XM_017029782.1 Intron XP_016885271.1
          XM_017029783.1 Intron XP_016885272.1
          XM_017029784.1 Intron XP_016885273.1
          XM_017029785.1 Intron XP_016885274.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          chromatin/chromatin-binding, or -regulatory protein

          Gene Ontology Categories:

          Function(s) Process(es)

          in utero embryonic development
          neural tube closure
          heart morphogenesis
          respiratory system process
          positive regulation of gene expression
          somite rostral/caudal axis specification
          multicellular organism growth
          mesodermal cell differentiation
          notochord morphogenesis
          histone H3-K4 methylation
          oxidation-reduction process
          canonical Wnt signaling pathway
          histone H3-K27 demethylation
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          chromatin DNA binding
          histone demethylase activity
          identical protein binding
          metal ion binding
          dioxygenase activity
          histone demethylase activity (H3-K27 specific)

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline