Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_362873163_10
          See other TNNT2 GT Assays ›
          SNP ID:
          rs757664792
          Gene
          TNNT2
          Gene Name
          troponin T2, cardiac type
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 201359242 - 201359242 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CAGCGCCCGGTGACTTTAGCCTTCC[C/T]GCGGGTCTTGGAGCTGCAGGGGAAG

          Assay ID C_362873163_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          2 submissions

          Phenotype:

          MIM: 191045

          Literature Links:

          TNNT2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          TNNT2 - troponin T2, cardiac type
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000364.3 1052 Missense Mutation AGG,GGG R,G 286 NP_000355.2
          NM_001001430.2 1052 Missense Mutation AGG,GGG R,G 279 NP_001001430.1
          NM_001001431.2 1052 Missense Mutation AGG,GGG R,G 276 NP_001001431.1
          NM_001001432.2 1052 Missense Mutation AGG,GGG R,G 273 NP_001001432.1
          NM_001276345.1 1052 Missense Mutation AGG,GGG R,G 289 NP_001263274.1
          NM_001276346.1 1052 Missense Mutation AGG,GGG R,G 246 NP_001263275.1
          NM_001276347.1 1052 Missense Mutation AGG,GGG R,G 279 NP_001263276.1
          XM_006711508.3 1052 Missense Mutation AGG,GGG R,G 279 XP_006711571.1
          XM_006711509.3 1052 Missense Mutation AGG,GGG R,G 278 XP_006711572.1
          XM_011509938.2 1052 Missense Mutation AGG,GGG R,G 289 XP_011508240.1
          XM_011509939.1 1052 Missense Mutation AGG,GGG R,G 288 XP_011508241.1
          XM_011509940.2 1052 Missense Mutation AGG,GGG R,G 288 XP_011508242.1
          XM_011509941.2 1052 Missense Mutation AGG,GGG R,G 287 XP_011508243.1
          XM_011509942.2 1052 Missense Mutation AGG,GGG R,G 274 XP_011508244.1
          XM_011509943.2 1052 Missense Mutation AGG,GGG R,G 274 XP_011508245.1
          XM_011509944.2 1052 Missense Mutation AGG,GGG R,G 273 XP_011508246.1
          XM_011509946.1 1052 Missense Mutation AGG,GGG R,G 220 XP_011508248.1
          XM_017002216.1 1052 Missense Mutation AGG,GGG R,G 278 XP_016857705.1
          XM_017002217.1 1052 Missense Mutation AGG,GGG R,G 276 XP_016857706.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          actin binding motor protein

          Gene Ontology Categories:

          Function(s) Process(es)

          regulation of heart contraction
          muscle filament sliding
          negative regulation of ATPase activity
          positive regulation of ATPase activity
          regulation of muscle filament sliding speed
          protein heterooligomerization
          response to calcium ion
          actin crosslink formation
          ventricular cardiac muscle tissue morphogenesis
          cardiac muscle contraction
          actin binding
          protein binding
          tropomyosin binding
          troponin C binding
          protein binding, bridging
          troponin I binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline