Search
LOADING 
- SNP ID:
- rs767299242
- Gene
-
DARS2GAS5GAS5-AS1SNORD44SNORD47SNORD78SNORD79SNORD80SNORD81 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.1: 173856108 - 173856108 on Build GRCh38
- Polymorphism:
- G/T, Transversion substitution
- Context Sequence [VIC/FAM]:
TGAATAAAAGAGTTCTAAGCATAAG[G/T]CTTTGGCCTCTGTTTGTTTGAAGCT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 610956
MIM: 608280
|
||||||||||||||||||||
Literature Links: |
DARS2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| DARS2 - aspartyl-tRNA synthetase 2, mitochondrial | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_018122.4 | Intron | NP_060592.2 | ||||
| XM_006711427.3 | Intron | XP_006711490.1 | ||||
| XM_011509711.2 | Intron | XP_011508013.1 | ||||
| GAS5 - growth arrest specific 5 (non-protein coding) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| GAS5-AS1 - GAS5 antisense RNA 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD44 - small nucleolar RNA, C/D box 44 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD47 - small nucleolar RNA, C/D box 47 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD78 - small nucleolar RNA, C/D box 78 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD79 - small nucleolar RNA, C/D box 79 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD80 - small nucleolar RNA, C/D box 80 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| SNORD81 - small nucleolar RNA, C/D box 81 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top