Search
Search

ADAM15
DCST1
DCST2
LOC100505666ACTCAGCTGCCGTCGTTGGTTTGAC[C/T]GCAAGCATGAACAGTGCATGAAGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
ADAM15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| ADAM15 - ADAM metallopeptidase domain 15 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| DCST1 - DC-STAMP domain containing 1 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001143687.2 | 907 | Missense Mutation | CGC,TGC | R,C 240 | NP_001137159.1 | |
| NM_152494.3 | 907 | Missense Mutation | CGC,TGC | R,C 265 | NP_689707.2 | |
| DCST2 - DC-STAMP domain containing 2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| LOC100505666 - uncharacterized LOC100505666 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||