Search
LOADING 
- SNP ID:
- rs780450489
- Gene
-
CNST - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.1: 246612622 - 246612622 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
TCATAACAGGTCAGGCGCAGTGGTT[C/T]GATCCAATAATCCTAGCACTTTGGG
Genomic Map
Back To TopAssay 상세 정보
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 613439
|
||||||||||||||||||||
Literature Links: |
CNST PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| CNST - consortin, connexin sorting protein | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001139459.1 | Intron | NP_001132931.1 | ||||
| NM_152609.2 | Intron | NP_689822.2 | ||||
| XM_005273081.3 | Intron | XP_005273138.2 | ||||
| XM_005273083.4 | Intron | XP_005273140.1 | ||||
| XM_011544110.2 | Intron | XP_011542412.1 | ||||
| XM_011544111.1 | Intron | XP_011542413.1 | ||||
| XM_011544112.1 | Intron | XP_011542414.1 | ||||
| XM_011544113.1 | Intron | XP_011542415.1 | ||||
| XM_011544114.2 | Intron | XP_011542416.1 | ||||
| XM_017000487.1 | Intron | XP_016855976.1 | ||||
| XM_017000488.1 | Intron | XP_016855977.1 | ||||
| XM_017000489.1 | Intron | XP_016855978.1 | ||||
Back To Top