Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_364817694_10
          See other MASP2 GT Assays ›
          SNP ID:
          rs781682055
          Gene
          MASP2 TARDBP
          Gene Name
          mannan binding lectin serine peptidase 2
          TAR DNA binding protein
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 11029466 - 11029466 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          AGCCAATTCTGGTTAAAAAAAAAAG[T/C]ACTATTAAAAGGCAGATTGCATTGA

          Assay ID C_364817694_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          4 submissions

          Phenotype:

          MIM: 605102 MIM: 605078

          Literature Links:

          MASP2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          MASP2 - mannan binding lectin serine peptidase 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_006610.3 Intron NP_006601.2
          NM_139208.2 Intron NP_631947.1
          XM_017000097.1 Intron XP_016855586.1
          TARDBP - TAR DNA binding protein
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_007375.3 Intron NP_031401.1
          XM_017000863.1 Intron XP_016856352.1
          XM_017000864.1 Intron XP_016856353.1
          XM_017000865.1 Intron XP_016856354.1
          XM_017000866.1 Intron XP_016856355.1
          XM_017000867.1 Intron XP_016856356.1
          XM_017000868.1 Intron XP_016856357.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          serine protease

          Gene Ontology Categories:

          Function(s) Process(es)

          complement activation, lectin pathway
          proteolysis
          complement activation
          complement activation, classical pathway
          negative regulation of protein phosphorylation
          transcription from RNA polymerase II promoter
          mRNA processing
          RNA splicing
          negative regulation of gene expression
          nuclear fragmentation involved in apoptotic nuclear change
          positive regulation of insulin secretion
          response to endoplasmic reticulum stress
          negative regulation by host of viral transcription
          positive regulation of transcription from RNA polymerase II promoter
          regulation of cell cycle
          3'-UTR-mediated mRNA stabilization
          nuclear inner membrane organization
          complement component C4b binding
          serine-type endopeptidase activity
          calcium ion binding
          protein binding
          peptidase activity
          calcium-dependent protein binding
          nucleotide binding
          transcriptional activator activity, RNA polymerase II distal enhancer sequence-specific binding
          double-stranded DNA binding
          transcription factor activity, sequence-specific DNA binding
          RNA binding
          mRNA 3'-UTR binding
          identical protein binding
          poly(A) RNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline