Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Veja todas as categorias de produtos
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_365627149_10
          See other NEB GT Assays ›
          SNP ID:
          rs376655029
          Gene
          NEB
          Gene Name
          nebulin
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 151567426 - 151567426 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          CCAGCTTAGGATCATCTCTCATCGT[C/T]GGGACACCAACATAATGACCTTTTT

          Assay ID C_365627149_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 161650

          Literature Links:

          NEB PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          NEB - nebulin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001164507.1 18088 Silent Mutation CCA,CCG P,P 5966 NP_001157979.1
          NM_001164508.1 18088 Silent Mutation CCA,CCG P,P 5966 NP_001157980.1
          NM_001271208.1 18088 Silent Mutation CCA,CCG P,P 5966 NP_001258137.1
          NM_004543.4 18088 Silent Mutation CCA,CCG P,P 4265 NP_004534.2
          XM_005246590.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246647.1
          XM_005246591.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246648.1
          XM_005246592.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246649.1
          XM_005246593.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246650.1
          XM_005246594.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246651.1
          XM_005246596.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246653.1
          XM_005246597.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246654.1
          XM_005246598.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246655.1
          XM_005246599.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246656.1
          XM_005246600.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246657.1
          XM_005246601.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246658.1
          XM_005246602.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246659.1
          XM_005246603.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246660.1
          XM_005246604.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246661.1
          XM_005246606.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246663.1
          XM_005246608.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246665.1
          XM_005246610.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246667.1
          XM_005246611.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246668.1
          XM_005246612.2 18088 Silent Mutation CCA,CCG P,P 5723 XP_005246669.1
          XM_005246613.2 18088 Silent Mutation CCA,CCG P,P 5723 XP_005246670.1
          XM_005246615.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246672.1
          XM_005246616.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_005246673.1
          XM_005246617.2 18088 Silent Mutation CCA,CCG P,P 4994 XP_005246674.1
          XM_006712541.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_006712604.1
          XM_006712542.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_006712605.1
          XM_011511225.2 18088 Silent Mutation CCA,CCG P,P 5966 XP_011509527.1
          XM_011511226.2 18088 Silent Mutation CCA,CCG P,P 5237 XP_011509528.1
          XM_011511227.2 18088 Silent Mutation CCA,CCG P,P 4508 XP_011509529.1
          XM_017004177.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859666.1
          XM_017004178.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859667.1
          XM_017004179.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859668.1
          XM_017004180.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859669.1
          XM_017004181.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859670.1
          XM_017004182.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859671.1
          XM_017004183.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859672.1
          XM_017004184.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859673.1
          XM_017004185.1 18088 Silent Mutation CCA,CCG P,P 5966 XP_016859674.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          muscle organ development
          somatic muscle development
          muscle filament sliding
          regulation of actin filament length
          actin binding
          protein binding
          structural constituent of muscle

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-green-794c4b9cd6-8pzg4:80/100.66.75.138:80.
          git-commit: 7e8dd63fde7d4486b98ef9ac5cf4e365aa842ffe
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.52.0-Offline