Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_365920647_10
          See other MROH2A GT Assays ›
          SNP ID:
          rs377501831
          Gene
          MROH2A UGT1A1 UGT1A10 UGT1A3 UGT1A4 UGT1A5 UGT1A6 UGT1A7 UGT1A8 UGT1A9
          Gene Name
          maestro heat like repeat family member 2A
          UDP glucuronosyltransferase family 1 member A1
          UDP glucuronosyltransferase family 1 member A10
          UDP glucuronosyltransferase family 1 member A3
          UDP glucuronosyltransferase family 1 member A4
          UDP glucuronosyltransferase family 1 member A5
          UDP glucuronosyltransferase family 1 member A6
          UDP glucuronosyltransferase family 1 member A7
          UDP glucuronosyltransferase family 1 member A8
          UDP glucuronosyltransferase family 1 member A9
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 233767899 - 233767899 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GACCATCGAATCTTGCGAACAACAC[G/A]ATACTTGTTAAGTGGCTACCCCAAA

          Assay ID C_365920647_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 191740 MIM: 606435 MIM: 606428 MIM: 606429 MIM: 606430 MIM: 606431 MIM: 606432 MIM: 606433 MIM: 606434

          Literature Links:

          MROH2A PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          MROH2A - maestro heat like repeat family member 2A
          There are no transcripts associated with this gene.
          UGT1A1 - UDP glucuronosyltransferase family 1 member A1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000463.2 1084 Silent Mutation ACA,ACG T,T 349 NP_000454.1
          UGT1A10 - UDP glucuronosyltransferase family 1 member A10
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_019075.2 1084 Silent Mutation ACA,ACG T,T 346 NP_061948.1
          UGT1A3 - UDP glucuronosyltransferase family 1 member A3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_019093.2 1084 Silent Mutation ACA,ACG T,T 350 NP_061966.1
          UGT1A4 - UDP glucuronosyltransferase family 1 member A4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_007120.2 1084 Silent Mutation ACA,ACG T,T 350 NP_009051.1
          UGT1A5 - UDP glucuronosyltransferase family 1 member A5
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_019078.1 1084 Silent Mutation ACA,ACG T,T 350 NP_061951.1
          UGT1A6 - UDP glucuronosyltransferase family 1 member A6
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001072.3 1084 Silent Mutation ACA,ACG T,T 348 NP_001063.2
          NM_205862.1 1084 Silent Mutation ACA,ACG T,T 81 NP_995584.1
          UGT1A7 - UDP glucuronosyltransferase family 1 member A7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_019077.2 1084 Silent Mutation ACA,ACG T,T 346 NP_061950.2
          UGT1A8 - UDP glucuronosyltransferase family 1 member A8
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_019076.4 1084 Silent Mutation ACA,ACG T,T 346 NP_061949.3
          UGT1A9 - UDP glucuronosyltransferase family 1 member A9
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_021027.2 1084 Silent Mutation ACA,ACG T,T 346 NP_066307.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          glycosyltransferase

          Gene Ontology Categories:

          Function(s) Process(es)

          liver development
          bilirubin conjugation
          acute-phase response
          response to nutrient
          digestion
          steroid metabolic process
          estrogen metabolic process
          flavonoid biosynthetic process
          drug metabolic process
          organ regeneration
          response to lipopolysaccharide
          heme catabolic process
          response to drug
          retinoic acid metabolic process
          response to starvation
          negative regulation of catalytic activity
          negative regulation of steroid metabolic process
          heterocycle metabolic process
          flavone metabolic process
          cellular glucuronidation
          flavonoid glucuronidation
          xenobiotic glucuronidation
          biphenyl catabolic process
          cellular response to ethanol
          cellular response to glucocorticoid stimulus
          metabolic process
          xenobiotic metabolic process
          excretion
          coumarin metabolic process
          fatty acid metabolic process
          negative regulation of fatty acid metabolic process
          retinoic acid binding
          enzyme inhibitor activity
          steroid binding
          glucuronosyltransferase activity
          enzyme binding
          protein homodimerization activity
          protein heterodimerization activity
          protein kinase C binding
          fatty acid binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline