Search
LOADING 
- SNP ID:
- rs749290931
- Gene
-
IL1F10IL36BIL36RN - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.2: 113062314 - 113062320 on Build GRCh38
- Polymorphism:
- CAGCCCA/-, Insertion/deletion
- Context Sequence [VIC/FAM]:
TGCTGAGCCTACTGAAGCCGGG[CAGCCCA/-]CAGCCCTGGTGCTGTGGGACAC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615296
MIM: 605508
MIM: 605507
|
||||||||||||||||||||
Literature Links: |
IL1F10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| IL1F10 - interleukin 1 family member 10 (theta) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| IL36B - interleukin 36, beta | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| IL36RN - interleukin 36 receptor antagonist | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_012275.2 | Intron | NP_036407.1 | ||||
| NM_173170.1 | Intron | NP_775262.1 | ||||
Back To Top