Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Productos
    • Anticuerpos
    • Oligonucleótidos, cebadores, sondas y genes
    • Ensayos de PCR en tiempo real TaqMan
    • Medios de cultivos celulares
    • Productos químicos
    • Columnas y cartuchos de cromatografía
    • Equipo de laboratorio
    • Material de plástico y suministros para laboratorio
    • Microplacas
    • Productos más ecológicos
    • Ver todas las categorías de productos
  • Applications
    • Bioprocesamiento
    • Cultivo celular y transfección
    • Terapia celular y génica
    • Cromatografía
    • Pruebas moleculares
    • Soluciones digitales
    • Extracción y análisis de ADN y ARN
    • Espectroscopía, análisis elemental y de isótopos
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Servicios personalizados
    • Servicios de leasing y financiación
    • Servicios de instrumentos
    • Informática de laboratorio
    • OEM y oferta comercial
    • Servicios de formación
    • Unity Lab Services
    • Ver todos los servicios
  • Ayuda y soporte técnico
    • Regístrese para obtener una cuenta
    • Cómo hacer un pedido
    • Asistencia para el instrumental
    • Centros de soporte técnico
    • Centros de formación
    • Vea todos los temas de ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Promociones
  • Contacto
  • Pedido rápido
  • Estado del pedido y seguimiento
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Estado del pedido
          • Pedido rápido
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Cuenta
            • Pedidos
            • Connect: laboratorio, datos, aplicaciones
            • Productos y proyectos personalizados
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_372044072_10
          See other LOC101927055 GT Assays ›
          SNP ID:
          rs766463184
          Gene
          LOC101927055 TTN
          Gene Name
          uncharacterized LOC101927055
          titin
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 178777453 - 178777453 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          GTTAAAATCACTGAAATTGAAGATC[T/C]GCCTGCCCTGTTTTGGGCAACCACA

          Assay ID C_372044072_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 188840

          Literature Links:

          LOC101927055 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          LOC101927055 - uncharacterized LOC101927055
          There are no transcripts associated with this gene.
          TTN - titin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001256850.1 4840 Missense Mutation AGA,GGA R,G 1538 NP_001243779.1
          NM_001267550.2 4840 Missense Mutation AGA,GGA R,G 1538 NP_001254479.2
          NM_003319.4 4840 Missense Mutation AGA,GGA R,G 1492 NP_003310.4
          NM_133378.4 4840 Missense Mutation AGA,GGA R,G 1538 NP_596869.4
          NM_133379.4 4840 Missense Mutation AGA,GGA R,G 1538 NP_596870.2
          NM_133432.3 4840 Missense Mutation AGA,GGA R,G 1492 NP_597676.3
          NM_133437.4 4840 Missense Mutation AGA,GGA R,G 1492 NP_597681.4
          XM_017004819.1 4840 Missense Mutation AGA,GGA R,G 1539 XP_016860308.1
          XM_017004820.1 4840 Missense Mutation AGA,GGA R,G 1539 XP_016860309.1
          XM_017004821.1 4840 Missense Mutation AGA,GGA R,G 1538 XP_016860310.1
          XM_017004822.1 4840 Missense Mutation AGA,GGA R,G 1539 XP_016860311.1
          XM_017004823.1 4840 Missense Mutation AGA,GGA R,G 1539 XP_016860312.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          platelet degranulation
          cardiac muscle hypertrophy
          muscle contraction
          striated muscle contraction
          mitotic chromosome condensation
          peptidyl-tyrosine phosphorylation
          muscle filament sliding
          skeletal muscle thin filament assembly
          skeletal muscle myosin thick filament assembly
          detection of muscle stretch
          sarcomere organization
          regulation of protein kinase activity
          cardiac muscle fiber development
          sarcomerogenesis
          regulation of catalytic activity
          response to calcium ion
          cardiac myofibril assembly
          cardiac muscle tissue morphogenesis
          cardiac muscle contraction
          protease binding
          protein serine/threonine kinase activity
          protein tyrosine kinase activity
          calcium ion binding
          protein binding
          calmodulin binding
          ATP binding
          structural constituent of muscle
          enzyme binding
          protein kinase binding
          telethonin binding
          identical protein binding
          actinin binding
          protein self-association
          actin filament binding
          muscle alpha-actinin binding
          structural molecule activity conferring elasticity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estado del pedido
          • Ayuda con el pedido
          • Pedido rápido
          • Centro de suministros
          • eProcurement (B2B)
          Asistencia Plus Icon Minus Icon
          • Ayuda y soporte técnico
          • Contacto
          • Centros de soporte técnico
          • Documentos y certificados
          • Informar de un problema del sitio web
          Recursos Plus Icon Minus Icon
          • Centros de formación
          • Promociones
          • Eventos y seminarios web
          • Redes sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Carreras profesionales Carreras profesionales
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas registradas
          • Políticas y avisos
          Nuestra cartera Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline