Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_372450732_10
          See other TTN GT Assays ›
          SNP ID:
          rs775718776
          Gene
          TTN
          Gene Name
          titin
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 178739259 - 178739259 on Build GRCh38
          Polymorphism:
          T/C, Transition substitution
          Context Sequence [VIC/FAM]:

          TTACTTTGTCGATGACTAGCGTATA[T/C]GTATTTTGATCTTGTAAACACTTGA

          Assay ID C_372450732_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 188840

          Literature Links:

          TTN PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          TTN - titin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001256850.1 13251 Silent Mutation ACA,ACG T,T 4341 NP_001243779.1
          NM_001267550.2 13251 Silent Mutation ACA,ACG T,T 4658 NP_001254479.2
          NM_003319.4 13251 Silent Mutation ACA,ACG T,T 4295 NP_003310.4
          NM_133378.4 13251 Intron NP_596869.4
          NM_133379.4 13251 Intron NP_596870.2
          NM_133432.3 13251 Silent Mutation ACA,ACG T,T 4420 NP_597676.3
          NM_133437.4 13251 Silent Mutation ACA,ACG T,T 4487 NP_597681.4
          XM_017004819.1 13251 Silent Mutation ACA,ACG T,T 4342 XP_016860308.1
          XM_017004820.1 13251 Intron XP_016860309.1
          XM_017004821.1 13251 Intron XP_016860310.1
          XM_017004822.1 13251 Silent Mutation ACA,ACG T,T 4342 XP_016860311.1
          XM_017004823.1 13251 Silent Mutation ACA,ACG T,T 4342 XP_016860312.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          platelet degranulation
          cardiac muscle hypertrophy
          muscle contraction
          striated muscle contraction
          mitotic chromosome condensation
          peptidyl-tyrosine phosphorylation
          muscle filament sliding
          skeletal muscle thin filament assembly
          skeletal muscle myosin thick filament assembly
          detection of muscle stretch
          sarcomere organization
          regulation of protein kinase activity
          cardiac muscle fiber development
          sarcomerogenesis
          regulation of catalytic activity
          response to calcium ion
          cardiac myofibril assembly
          cardiac muscle tissue morphogenesis
          cardiac muscle contraction
          protease binding
          protein serine/threonine kinase activity
          protein tyrosine kinase activity
          calcium ion binding
          protein binding
          calmodulin binding
          ATP binding
          structural constituent of muscle
          enzyme binding
          protein kinase binding
          telethonin binding
          identical protein binding
          actinin binding
          protein self-association
          actin filament binding
          muscle alpha-actinin binding
          structural molecule activity conferring elasticity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline