Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Productos
    • Anticuerpos
    • Oligonucleótidos, cebadores, sondas y genes
    • Ensayos de PCR en tiempo real TaqMan
    • Medios de cultivos celulares
    • Productos químicos
    • Columnas y cartuchos de cromatografía
    • Equipo de laboratorio
    • Material de plástico y suministros para laboratorio
    • Microplacas
    • Productos más ecológicos
    • Ver todas las categorías de productos
  • Applications
    • Bioprocesamiento
    • Cultivo celular y transfección
    • Terapia celular y génica
    • Cromatografía
    • Pruebas moleculares
    • Soluciones digitales
    • Extracción y análisis de ADN y ARN
    • Espectroscopía, análisis elemental y de isótopos
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Servicios personalizados
    • Servicios de leasing y financiación
    • Servicios de instrumentos
    • Informática de laboratorio
    • OEM y oferta comercial
    • Servicios de formación
    • Unity Lab Services
    • Ver todos los servicios
  • Ayuda y soporte técnico
    • Regístrese para obtener una cuenta
    • Cómo hacer un pedido
    • Asistencia para el instrumental
    • Centros de soporte técnico
    • Centros de formación
    • Vea todos los temas de ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Promociones
  • Contacto
  • Pedido rápido
  • Estado del pedido y seguimiento
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Estado del pedido
          • Pedido rápido
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Cuenta
            • Pedidos
            • Connect: laboratorio, datos, aplicaciones
            • Productos y proyectos personalizados
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_372853526_10
          See other IL1F10 GT Assays ›
          SNP ID:
          rs779082939
          Gene
          IL1F10 IL36B IL36RN
          Gene Name
          interleukin 1 family member 10 (theta)
          interleukin 36, beta
          interleukin 36 receptor antagonist
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 113061091 - 113061091 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AACCAGGCTCTAAGCAAAGGCAAAT[A/G]AAATACTACACCTCTCAGCAAAGTG

          Assay ID C_372853526_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 615296 MIM: 605508 MIM: 605507

          Literature Links:

          IL1F10 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          IL1F10 - interleukin 1 family member 10 (theta)
          There are no transcripts associated with this gene.
          IL36B - interleukin 36, beta
          There are no transcripts associated with this gene.
          IL36RN - interleukin 36 receptor antagonist
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_012275.2 Intron NP_036407.1
          NM_173170.1 Intron NP_775262.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          interleukin superfamily

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of cytokine-mediated signaling pathway
          antifungal humoral response
          negative regulation of interleukin-17 production
          negative regulation of interleukin-6 production
          innate immune response
          negative regulation of interferon-gamma secretion
          cytokine activity
          interleukin-1 receptor binding
          interleukin-1 receptor antagonist activity
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estado del pedido
          • Ayuda con el pedido
          • Pedido rápido
          • Centro de suministros
          • eProcurement (B2B)
          Asistencia Plus Icon Minus Icon
          • Ayuda y soporte técnico
          • Contacto
          • Centros de soporte técnico
          • Documentos y certificados
          • Informar de un problema del sitio web
          Recursos Plus Icon Minus Icon
          • Centros de formación
          • Promociones
          • Eventos y seminarios web
          • Redes sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Carreras profesionales Carreras profesionales
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas registradas
          • Políticas y avisos
          Nuestra cartera Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline