Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_380972819_10
          See other GALNT7 GT Assays ›
          SNP ID:
          rs369321761
          Gene
          GALNT7 HMGB2 LOC105377538
          Gene Name
          polypeptide N-acetylgalactosaminyltransferase 7
          high mobility group box 2
          uncharacterized LOC105377538
          Set Membership:
          -
          Chromosome Location:
          Chr.4: 173332692 - 173332692 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CAATTACCTTGTGTTGAAGTGTACA[A/G]TTTTCATTAGGCCTTTTCAAAACAT

          Assay ID C_380972819_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605005 MIM: 163906

          Literature Links:

          GALNT7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          GALNT7 - polypeptide N-acetylgalactosaminyltransferase 7
          There are no transcripts associated with this gene.
          HMGB2 - high mobility group box 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001130688.1 Intron NP_001124160.1
          NM_001130689.1 Intron NP_001124161.1
          NM_002129.3 Intron NP_002120.1
          LOC105377538 - uncharacterized LOC105377538
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of endothelial cell proliferation
          inflammatory response to antigenic stimulus
          DNA topological change
          apoptotic DNA fragmentation
          chromatin organization
          nucleosome assembly
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          spermatid nucleus differentiation
          male gonad development
          positive regulation of nuclease activity
          DNA geometric change
          response to lipopolysaccharide
          positive regulation of interferon-beta production
          V(D)J recombination
          response to drug
          positive regulation of DNA binding
          innate immune response
          positive regulation of innate immune response
          positive regulation of erythrocyte differentiation
          positive regulation of megakaryocyte differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          response to steroid hormone
          regulation of neurogenesis
          defense response to Gram-negative bacterium
          defense response to Gram-positive bacterium
          positive chemotaxis
          DNA ligation involved in DNA repair
          cell chemotaxis
          cellular response to lipopolysaccharide
          regulation of stem cell proliferation
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          four-way junction DNA binding
          enhancer sequence-specific DNA binding
          DNA binding
          damaged DNA binding
          double-stranded DNA binding
          single-stranded DNA binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          transcription factor binding
          drug binding
          DNA binding, bending
          protein domain specific binding
          chemoattractant activity
          transcription regulatory region DNA binding
          non-sequence-specific DNA binding, bending
          poly(A) RNA binding
          RAGE receptor binding
          supercoiled DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-tr4x4:80/100.66.75.98:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline