Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Quem atendemos
    • Setor de Biotecnologia
    • Indústria Biofarmacêutica
    • CDMO
    • Diagnósticos Laboratoriais
    • Ciência Industrial e Aplicada
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_391632660_10
          See other NSUN2 GT Assays ›
          SNP ID:
          rs751682504
          Gene
          NSUN2 SRD5A1
          Gene Name
          NOP2/Sun RNA methyltransferase family member 2
          steroid 5 alpha-reductase 1
          Set Membership:
          -
          Chromosome Location:
          Chr.5: 6636632 - 6636632 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CAGCAGCAGAGCTACAGCTCTTCCC[A/G]GAGCAACTGACTGTTCTGGGAACAA

          Assay ID C_391632660_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610916 MIM: 184753

          Literature Links:

          NSUN2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          NSUN2 - NOP2/Sun RNA methyltransferase family member 2
          There are no transcripts associated with this gene.
          SRD5A1 - steroid 5 alpha-reductase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001047.3 Intron NP_001038.1
          NM_001324322.1 Intron NP_001311251.1
          NM_001324323.1 Intron NP_001311252.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          dehydrogenase

          Gene Ontology Categories:

          Function(s) Process(es)

          urogenital system development
          liver development
          steroid biosynthetic process
          androgen biosynthetic process
          sex determination
          male gonad development
          cellular response to starvation
          response to muscle activity
          diterpenoid metabolic process
          spinal cord development
          hippocampus development
          thalamus development
          hypothalamus development
          pituitary gland development
          cerebral cortex development
          cell differentiation
          male genitalia development
          female genitalia development
          response to follicle-stimulating hormone
          cellular response to insulin stimulus
          serotonin metabolic process
          progesterone metabolic process
          response to drug
          circadian sleep/wake cycle, REM sleep
          response to estrogen
          oxidation-reduction process
          bone development
          response to growth hormone
          response to fungicide
          cellular response to cAMP
          cellular response to growth factor stimulus
          cellular response to estradiol stimulus
          cellular response to testosterone stimulus
          cellular response to dexamethasone stimulus
          cellular response to epinephrine stimulus
          3-oxo-5-alpha-steroid 4-dehydrogenase activity
          electron carrier activity
          amide binding
          cholestenone 5-alpha-reductase activity
          NADPH binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-9kpsn:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0