Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_392877833_10
          See other MAPK9 GT Assays ›
          SNP ID:
          rs777237633
          Gene
          MAPK9
          Gene Name
          mitogen-activated protein kinase 9
          Set Membership:
          -
          Chromosome Location:
          Chr.5: 180265913 - 180265913 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AAATCTAAAACATGAAATAAAACCT[C/G]AGAATATAGATAAACATTTATATAA

          Assay ID C_392877833_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602896

          Literature Links:

          MAPK9 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          MAPK9 - mitogen-activated protein kinase 9
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001135044.1 Intron NP_001128516.1
          NM_001308244.1 Intron NP_001295173.1
          NM_002752.4 Intron NP_002743.3
          NM_139068.2 Intron NP_620707.1
          NM_139069.2 Intron NP_620708.1
          NM_139070.2 Intron NP_620709.1
          XM_005265940.4 Intron XP_005265997.1
          XM_006714891.2 Intron XP_006714954.1
          XM_017009638.1 Intron XP_016865127.1
          XM_017009639.1 Intron XP_016865128.1
          XM_017009640.1 Intron XP_016865129.1
          XM_017009641.1 Intron XP_016865130.1
          XM_017009642.1 Intron XP_016865131.1
          XM_017009643.1 Intron XP_016865132.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          release of cytochrome c from mitochondria
          positive regulation of protein phosphorylation
          protein phosphorylation
          protein targeting to mitochondrion
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          response to stress
          JNK cascade
          JUN phosphorylation
          central nervous system development
          response to mechanical stimulus
          response to toxic substance
          positive regulation of gene expression
          positive regulation of macrophage derived foam cell differentiation
          positive regulation of cell morphogenesis involved in differentiation
          response to amine
          neuron projection development
          positive regulation of prostaglandin biosynthetic process
          regulation of protein ubiquitination
          positive regulation of prostaglandin secretion
          positive regulation of chemokine production
          cellular response to UV
          Fc-epsilon receptor signaling pathway
          response to drug
          regulation of circadian rhythm
          positive regulation of nitric oxide biosynthetic process
          positive regulation of transcription, DNA-templated
          regulation of JNK cascade
          response to cadmium ion
          rhythmic process
          regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of nitric-oxide synthase biosynthetic process
          cellular response to lipopolysaccharide
          cellular response to interleukin-1
          cellular response to tumor necrosis factor
          cellular response to growth factor stimulus
          positive regulation of podosome assembly
          positive regulation of apoptotic signaling pathway
          JUN kinase activity
          protein binding
          ATP binding
          transcription factor binding
          cysteine-type endopeptidase activator activity involved in apoptotic process
          mitogen-activated protein kinase kinase kinase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline