Search
LOADING 
- SNP ID:
- rs761022821
- Gene
-
C2EHMT2ZBTB12 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.6: 31902505 - 31902505 on Build GRCh38
- Polymorphism:
- G/T, Transversion substitution
- Context Sequence [VIC/FAM]:
GCCGAGCGCTGCCCTGGGTGCATCC[G/T]TGGCACCTCTCAGGGCCCCATCCGC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613927
MIM: 604599
|
||||||||||||||||||||
Literature Links: |
C2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| C2 - complement component 2 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000063.5 | Intron | NP_000054.2 | ||||
| NM_001145903.2 | Intron | NP_001139375.1 | ||||
| NM_001178063.2 | Intron | NP_001171534.1 | ||||
| NM_001282457.1 | Intron | NP_001269386.1 | ||||
| NM_001282458.1 | Intron | NP_001269387.1 | ||||
| NM_001282459.1 | Intron | NP_001269388.1 | ||||
| EHMT2 - euchromatic histone lysine methyltransferase 2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| ZBTB12 - zinc finger and BTB domain containing 12 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_181842.2 | Intron | NP_862825.1 | ||||
| XM_011514383.2 | Intron | XP_011512685.2 | ||||
Back To Top