Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_399478672_10
          See other CUL1 GT Assays ›
          SNP ID:
          rs373975096
          Gene
          CUL1 EZH2
          Gene Name
          cullin 1
          enhancer of zeste 2 polycomb repressive complex 2 subunit
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 148807670 - 148807670 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GTCAAGGGATTTCCATTTCTCTTTC[G/A]ATGCCGACATACTTCAGGGCATCAG

          Assay ID C_399478672_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603134 MIM: 601573

          Literature Links:

          CUL1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CUL1 - cullin 1
          There are no transcripts associated with this gene.
          EZH2 - enhancer of zeste 2 polycomb repressive complex 2 subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001203247.1 4751 Silent Mutation ATC,ATT I,I 739 NP_001190176.1
          NM_001203248.1 4751 Silent Mutation ATC,ATT I,I 730 NP_001190177.1
          NM_001203249.1 4751 Silent Mutation ATC,ATT I,I 688 NP_001190178.1
          NM_004456.4 4751 Silent Mutation ATC,ATT I,I 744 NP_004447.2
          NM_152998.2 4751 Silent Mutation ATC,ATT I,I 700 NP_694543.1
          XM_005249962.4 4751 Silent Mutation ATC,ATT I,I 747 XP_005250019.1
          XM_005249963.4 4751 Silent Mutation ATC,ATT I,I 738 XP_005250020.1
          XM_005249964.4 4751 Silent Mutation ATC,ATT I,I 696 XP_005250021.1
          XM_011515883.2 4751 Silent Mutation ATC,ATT I,I 752 XP_011514185.1
          XM_011515884.2 4751 Silent Mutation ATC,ATT I,I 744 XP_011514186.1
          XM_011515885.2 4751 Silent Mutation ATC,ATT I,I 743 XP_011514187.1
          XM_011515886.2 4751 Silent Mutation ATC,ATT I,I 736 XP_011514188.1
          XM_011515887.2 4751 Silent Mutation ATC,ATT I,I 735 XP_011514189.1
          XM_011515888.2 4751 Silent Mutation ATC,ATT I,I 735 XP_011514190.1
          XM_011515889.2 4751 Silent Mutation ATC,ATT I,I 722 XP_011514191.1
          XM_011515890.2 4751 Silent Mutation ATC,ATT I,I 713 XP_011514192.1
          XM_011515891.2 4751 Silent Mutation ATC,ATT I,I 711 XP_011514193.1
          XM_011515892.2 4751 Silent Mutation ATC,ATT I,I 710 XP_011514194.1
          XM_011515893.2 4751 Silent Mutation ATC,ATT I,I 708 XP_011514195.1
          XM_011515894.2 4751 Silent Mutation ATC,ATT I,I 705 XP_011514196.1
          XM_011515895.2 4751 Silent Mutation ATC,ATT I,I 704 XP_011514197.1
          XM_011515896.2 4751 Silent Mutation ATC,ATT I,I 666 XP_011514198.1
          XM_011515897.2 4751 Silent Mutation ATC,ATT I,I 635 XP_011514199.1
          XM_011515898.2 4751 Silent Mutation ATC,ATT I,I 635 XP_011514200.1
          XM_011515899.2 4751 Intron XP_011514201.1
          XM_011515901.2 4751 Intron XP_011514203.1
          XM_017011817.1 4751 Silent Mutation ATC,ATT I,I 752 XP_016867306.1
          XM_017011818.1 4751 Silent Mutation ATC,ATT I,I 731 XP_016867307.1
          XM_017011819.1 4751 Silent Mutation ATC,ATT I,I 705 XP_016867308.1
          XM_017011820.1 4751 Silent Mutation ATC,ATT I,I 696 XP_016867309.1
          XM_017011821.1 4751 Silent Mutation ATC,ATT I,I 630 XP_016867310.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          histone modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          DNA methylation
          chromatin organization
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          positive regulation of epithelial to mesenchymal transition
          regulation of gliogenesis
          skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration
          cerebellar cortex development
          hippocampus development
          response to estradiol
          negative regulation of transcription elongation from RNA polymerase II promoter
          regulation of cell proliferation
          regulation of circadian rhythm
          positive regulation of MAP kinase activity
          negative regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of GTPase activity
          negative regulation of epidermal cell differentiation
          negative regulation of gene expression, epigenetic
          negative regulation of transcription, DNA-templated
          negative regulation of retinoic acid receptor signaling pathway
          rhythmic process
          negative regulation of striated muscle cell differentiation
          cellular response to hydrogen peroxide
          G1 to G0 transition
          histone H3-K27 methylation
          protein localization to chromatin
          positive regulation of protein serine/threonine kinase activity
          positive regulation of dendrite development
          negative regulation of G1/S transition of mitotic cell cycle
          core promoter binding
          DNA binding
          chromatin binding
          RNA binding
          protein binding
          protein-lysine N-methyltransferase activity
          histone-lysine N-methyltransferase activity
          chromatin DNA binding
          histone methyltransferase activity
          ribonucleoprotein complex binding
          sequence-specific DNA binding
          histone methyltransferase activity (H3-K27 specific)
          promoter-specific chromatin binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline