Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_403758159_10
          See other SHH GT Assays ›
          SNP ID:
          rs767069944
          Gene
          SHH
          Gene Name
          sonic hedgehog
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 155811003 - 155811003 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TTTGCTTAGCTTCCCCTCCCCCCAC[A/G]CTAATATTTATTCGCTCTTAATTCT

          Assay ID C_403758159_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600725

          Literature Links:

          SHH PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          SHH - sonic hedgehog
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000193.3 812 Intron NP_000184.1
          NM_001310462.1 812 Intron NP_001297391.1
          XM_011516479.2 812 UTR 5 XP_011514781.1
          XM_011516480.2 812 UTR 5 XP_011514782.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          patterning of blood vessels
          vasculogenesis
          metanephros development
          branching involved in ureteric bud morphogenesis
          cell fate specification
          neural crest cell migration
          heart looping
          positive regulation of neuroblast proliferation
          osteoblast development
          lymphoid progenitor cell differentiation
          determination of left/right asymmetry in lateral mesoderm
          endocytosis
          smoothened signaling pathway
          positive regulation of hh target transcription factor activity
          cell-cell signaling
          pattern specification process
          ectoderm development
          neuroblast proliferation
          axon guidance
          central nervous system development
          ventral midline development
          hindgut morphogenesis
          heart development
          blood coagulation
          androgen metabolic process
          positive regulation of cell proliferation
          embryo development
          embryonic pattern specification
          polarity specification of anterior/posterior axis
          dorsal/ventral pattern formation
          oligodendrocyte development
          striated muscle tissue development
          positive regulation of skeletal muscle cell proliferation
          myotube differentiation
          intein-mediated protein splicing
          spinal cord dorsal/ventral patterning
          spinal cord motor neuron differentiation
          thalamus development
          dorsal/ventral neural tube patterning
          cerebellar granule cell precursor proliferation
          smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation
          telencephalon regionalization
          establishment of cell polarity
          regulation of proteolysis
          positive regulation of Wnt signaling pathway
          lung development
          embryonic limb morphogenesis
          negative regulation of cell migration
          male genitalia development
          prostate gland development
          thyroid gland development
          forebrain development
          midbrain development
          hindbrain development
          pancreas development
          hair follicle morphogenesis
          negative regulation of proteasomal ubiquitin-dependent protein catabolic process
          T cell differentiation in thymus
          positive regulation of T cell differentiation in thymus
          positive regulation of immature T cell proliferation in thymus
          negative regulation of transcription elongation from RNA polymerase II promoter
          protein localization to nucleus
          embryonic forelimb morphogenesis
          embryonic hindlimb morphogenesis
          regulation of cell proliferation
          negative regulation of T cell proliferation
          positive regulation of protein import into nucleus
          odontogenesis of dentin-containing tooth
          regulation of odontogenesis
          embryonic digit morphogenesis
          camera-type eye development
          negative regulation of apoptotic process
          CD4-positive or CD8-positive, alpha-beta T cell lineage commitment
          positive thymic T cell selection
          negative thymic T cell selection
          intermediate filament organization
          myoblast differentiation
          negative regulation of cell differentiation
          positive regulation of smoothened signaling pathway
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of alpha-beta T cell differentiation
          negative regulation of alpha-beta T cell differentiation
          cell development
          thymus development
          embryonic digestive tract morphogenesis
          embryonic foregut morphogenesis
          positive regulation of skeletal muscle tissue development
          organ formation
          neuron fate commitment
          embryonic skeletal system development
          positive regulation of oligodendrocyte differentiation
          branching morphogenesis of an epithelial tube
          inner ear development
          formation of anatomical boundary
          stem cell development
          positive regulation of striated muscle cell differentiation
          positive regulation of cell division
          Bergmann glial cell differentiation
          palate development
          canonical Wnt signaling pathway
          limb bud formation
          lung epithelium development
          trachea morphogenesis
          branching involved in salivary gland morphogenesis
          bud outgrowth involved in lung branching
          right lung development
          left lung development
          lung lobe morphogenesis
          lung-associated mesenchyme development
          primary prostatic bud elongation
          prostate epithelial cord elongation
          salivary gland cavitation
          epithelial cell proliferation involved in salivary gland morphogenesis
          regulation of prostatic bud formation
          epithelial-mesenchymal signaling involved in prostate gland development
          positive regulation of epithelial cell proliferation involved in prostate gland development
          regulation of mesenchymal cell proliferation involved in prostate gland development
          mesenchymal smoothened signaling pathway involved in prostate gland development
          artery development
          mesenchymal cell proliferation involved in lung development
          somite development
          positive regulation of sclerotome development
          cellular response to lithium ion
          dopaminergic neuron differentiation
          renal system development
          metanephric mesenchymal cell proliferation involved in metanephros development
          multicellular structure septum development
          negative regulation of canonical Wnt signaling pathway
          negative regulation of cholesterol efflux
          apoptotic signaling pathway
          regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry
          regulation of protein localization to nucleus
          negative regulation of dopaminergic neuron differentiation
          negative regulation of ureter smooth muscle cell differentiation
          positive regulation of ureter smooth muscle cell differentiation
          negative regulation of kidney smooth muscle cell differentiation
          positive regulation of kidney smooth muscle cell differentiation
          positive regulation of mesenchymal cell proliferation involved in ureter development
          negative regulation of mesenchymal cell apoptotic process
          glycoprotein binding
          patched binding
          calcium ion binding
          protein binding
          glycosaminoglycan binding
          peptidase activity
          zinc ion binding
          morphogen activity
          laminin-1 binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline