Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Quem atendemos
    • Setor de Biotecnologia
    • Indústria Biofarmacêutica
    • CDMO
    • Diagnósticos Laboratoriais
    • Ciência Industrial e Aplicada
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_404233333_10
          See other IMMP2L GT Assays ›
          SNP ID:
          rs776651279
          Gene
          IMMP2L LRRN3
          Gene Name
          inner mitochondrial membrane peptidase subunit 2
          leucine rich repeat neuronal 3
          Set Membership:
          -
          Chromosome Location:
          Chr.7: 111103274 - 111103274 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TGTACTTCTTTATCTCTATCTATTC[C/T]GTTGCCAACAAGCATACACGTATAC

          Assay ID C_404233333_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605977

          Literature Links:

          IMMP2L PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          IMMP2L - inner mitochondrial membrane peptidase subunit 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001244606.1 Intron NP_001231535.1
          NM_032549.3 Intron NP_115938.1
          XM_005250630.3 Intron XP_005250687.1
          XM_011516605.2 Intron XP_011514907.1
          XM_011516608.2 Intron XP_011514910.1
          XM_011516609.2 Intron XP_011514911.1
          XM_011516611.2 Intron XP_011514913.1
          XM_011516613.2 Intron XP_011514915.1
          XM_017012699.1 Intron XP_016868188.1
          XM_017012700.1 Intron XP_016868189.1
          XM_017012701.1 Intron XP_016868190.1
          XM_017012702.1 Intron XP_016868191.1
          XM_017012703.1 Intron XP_016868192.1
          XM_017012704.1 Intron XP_016868193.1
          XM_017012705.1 Intron XP_016868194.1
          LRRN3 - leucine rich repeat neuronal 3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001099658.1 Intron NP_001093128.1
          NM_001099660.1 Intron NP_001093130.1
          NM_018334.4 Intron NP_060804.3

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          protease transmembrane signal receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          ovarian follicle development
          signal peptide processing
          protein processing involved in protein targeting to mitochondrion
          superoxide metabolic process
          cellular response to DNA damage stimulus
          spermatogenesis
          brain development
          blood circulation
          respiratory electron transport chain
          ovulation
          mitochondrial respiratory chain complex assembly
          cerebellum vasculature development
          serine-type endopeptidase activity
          peptidase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline