Search
LOADING 
- SNP ID:
- rs772619684
- Gene
-
IMMP2LLRRN3 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.7: 111098687 - 111098687 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
TTTCTCATTTAATCTTCATAACGAC[C/T]GTACTAAGTAAGCGCTATGTTTAAC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605977
|
||||||||||||||||||||
Literature Links: |
IMMP2L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| IMMP2L - inner mitochondrial membrane peptidase subunit 2 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001244606.1 | Intron | NP_001231535.1 | ||||
| NM_032549.3 | Intron | NP_115938.1 | ||||
| XM_005250630.3 | Intron | XP_005250687.1 | ||||
| XM_011516605.2 | Intron | XP_011514907.1 | ||||
| XM_011516608.2 | Intron | XP_011514910.1 | ||||
| XM_011516609.2 | Intron | XP_011514911.1 | ||||
| XM_011516611.2 | Intron | XP_011514913.1 | ||||
| XM_011516613.2 | Intron | XP_011514915.1 | ||||
| XM_017012699.1 | Intron | XP_016868188.1 | ||||
| XM_017012700.1 | Intron | XP_016868189.1 | ||||
| XM_017012701.1 | Intron | XP_016868190.1 | ||||
| XM_017012702.1 | Intron | XP_016868191.1 | ||||
| XM_017012703.1 | Intron | XP_016868192.1 | ||||
| XM_017012704.1 | Intron | XP_016868193.1 | ||||
| XM_017012705.1 | Intron | XP_016868194.1 | ||||
| LRRN3 - leucine rich repeat neuronal 3 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001099658.1 | Intron | NP_001093128.1 | ||||
| NM_001099660.1 | Intron | NP_001093130.1 | ||||
| NM_018334.4 | Intron | NP_060804.3 | ||||
Back To Top