Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • Nunc/Nalgene Product Certificates
    • e-learning
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_60538594B_20
          See other ACE GT Assays ›
          SNP ID:
          rs1799752
          Gene
          ACE
          Gene Name
          angiotensin I converting enzyme
          Set Membership:
          -
          Chromosome Location:
          Chr.17: 63488529 - 63488530 on Build GRCh38
          Polymorphism:
          REF/-, Insertion/deletion
          Context Sequence [VIC/FAM]:

          CCCATTTCTCTAGACCTGCTGCCT[REF/-]ATACAGTCACTTTTATGTGGTTTC

          Assay ID C_60538594B_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 106180

          Literature Links:

          ACE PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ACE - angiotensin I converting enzyme
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000789.3 Intron NP_000780.1
          NM_001178057.1 Intron NP_001171528.1
          NM_152830.2 Intron NP_690043.1

          Back To Top

          More Information


          Important Information

          The ACE I/D polymorphism is an insertion/deletion of an Alu repeat sequence that is interrogated using a pair of assays. Assay C_60538594B_20 reports the wild type deletion allele (VIC probe) and C_60538594A_10 reports the mutant Alu insertion allele (FAM probe) of the ACE I/D variant. Each assay must be run separately on samples followed by comparative data analysis. A heterozygous sample will amplify with both assays whereas homozygous samples will amplify with only one assay.
          Assay C_60538594A_10 reports the mutant allele (FAM probe) of the ACE I/D variant.

          Panther Classification:

          Molecular Function -

          metalloprotease

          Gene Ontology Categories:

          Function(s) Process(es)

          kidney development
          blood vessel remodeling
          angiotensin maturation
          angiotensin catabolic process in blood
          regulation of renal output by angiotensin
          neutrophil mediated immunity
          antigen processing and presentation of peptide antigen via MHC class I
          regulation of systemic arterial blood pressure by renin-angiotensin
          spermatogenesis
          regulation of blood pressure
          regulation of smooth muscle cell migration
          regulation of vasoconstriction
          mononuclear cell proliferation
          regulation of vasodilation
          hormone catabolic process
          peptide catabolic process
          beta-amyloid metabolic process
          arachidonic acid secretion
          heart contraction
          regulation of angiotensin metabolic process
          hematopoietic stem cell differentiation
          positive regulation of protein tyrosine kinase activity
          cell proliferation in bone marrow
          positive regulation of peptidyl-tyrosine autophosphorylation
          regulation of hematopoietic stem cell proliferation
          negative regulation of gap junction assembly
          positive regulation of peptidyl-cysteine S-nitrosylation
          endopeptidase activity
          carboxypeptidase activity
          drug binding
          metallopeptidase activity
          exopeptidase activity
          tripeptidyl-peptidase activity
          peptidyl-dipeptidase activity
          zinc ion binding
          chloride ion binding
          mitogen-activated protein kinase kinase binding
          bradykinin receptor binding
          mitogen-activated protein kinase binding
          metallodipeptidase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-9kpsn:80/100.66.79.221:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0