Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__11227737_10
          See other CLU GT Assays ›
          SNP ID:
          rs11136000
          Gene
          CLU EPHX2 MIR6843
          Gene Name
          clusterin
          epoxide hydrolase 2
          microRNA 6843
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.8: 27607002 - 27607002 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          ACCAAAGCCACACCAGCTATCAAAA[C/T]TCTCTAACGGGCCCTTGCCACTTGA

          Assay ID C__11227737_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 185430 MIM: 132811

          Literature Links:

          CLU PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.38)
          (0.62)
          Caucasian - Not Available CEPH (CEU)
          T (0.35)
          (0.65)
          EAS
          T (0.22)
          (0.78)
          African American - Not Available YRI (Yoruba)
          C (0.43)
          (0.57)
          SAS
          T (0.28)
          (0.72)
          Chinese - Not Available JPT (Japanese)
          T (0.23)
          (0.77)
          AFR
          C (0.43)
          (0.57)
          Japanese - Not Available CHB (Han Chinese)
          T (0.23)
          (0.77)
          EUR
          T (0.39)
          (0.61)
          AMR
          T (0.36)
          (0.64)
          CLU - clusterin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001831.3 Intron NP_001822.3
          XM_006716284.2 Intron XP_006716347.1
          EPHX2 - epoxide hydrolase 2
          There are no transcripts associated with this gene.
          MIR6843 - microRNA 6843
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          cell morphogenesis
          microglial cell activation
          release of cytochrome c from mitochondria
          platelet degranulation
          lipid metabolic process
          complement activation
          complement activation, classical pathway
          aging
          positive regulation of cell proliferation
          response to light stimulus
          response to wounding
          response to virus
          protein import
          endocrine pancreas development
          central nervous system myelin maintenance
          positive regulation of proteasomal ubiquitin-dependent protein catabolic process
          negative regulation of protein homooligomerization
          positive regulation of tumor necrosis factor production
          response to potassium ion
          reverse cholesterol transport
          estrous cycle
          innate immune response
          positive regulation of nitric oxide biosynthetic process
          positive regulation of cell differentiation
          neuron projection morphogenesis
          protein stabilization
          positive regulation of NF-kappaB transcription factor activity
          chaperone-mediated protein complex assembly
          response to misfolded protein
          chaperone-mediated protein folding
          microglial cell proliferation
          cellular response to growth factor stimulus
          regulation of beta-amyloid clearance
          regulation of neuron death
          positive regulation of neuron death
          positive regulation of beta-amyloid formation
          negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage
          negative regulation of beta-amyloid formation
          regulation of neuronal signal transduction
          positive regulation of tau-protein kinase activity
          positive regulation of neurofibrillary tangle assembly
          positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process
          protein binding
          ATPase activity
          ubiquitin protein ligase binding
          protein N-terminus binding
          chaperone binding
          misfolded protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-blue-fcf5f9d6d-kf28v:80/100.66.78.203:80.
          git-commit: 856de8fa7eff2d55603d92afdf035972e45c3e8a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.51.0-2026.05.21-1.0