Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__11290211_20
          See other TCF7L2 GT Assays ›
          SNP ID:
          rs7919409
          Gene
          TCF7L2
          Gene Name
          transcription factor 7 like 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 113065217 - 113065217 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GTGTGGCCTATGAGGATGTTGTTTA[C/T]CAGGCAGCAACCTCATGAATAGGCA

          Assay ID C__11290211_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602228

          Literature Links:

          TCF7L2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.23)
          (0.77)
          Caucasian - Not Available CEPH (CEU)
          C (0.10)
          (0.90)
          EAS
          C (0.27)
          (0.73)
          African American - Not Available YRI (Yoruba)
          C (0.37)
          (0.63)
          SAS
          C (0.13)
          (0.87)
          Chinese - Not Available JPT (Japanese)
          C (0.21)
          (0.79)
          AFR
          C (0.37)
          (0.63)
          Japanese - Not Available CHB (Han Chinese)
          C (0.26)
          (0.74)
          EUR
          C (0.12)
          (0.88)
          AMR
          C (0.21)
          (0.79)
          TCF7L2 - transcription factor 7 like 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001146274.1 Intron NP_001139746.1
          NM_001146283.1 Intron NP_001139755.1
          NM_001146284.1 Intron NP_001139756.1
          NM_001146285.1 Intron NP_001139757.1
          NM_001146286.1 Intron NP_001139758.1
          NM_001198525.1 Intron NP_001185454.1
          NM_001198526.1 Intron NP_001185455.1
          NM_001198527.1 Intron NP_001185456.1
          NM_001198528.1 Intron NP_001185457.1
          NM_001198529.1 Intron NP_001185458.1
          NM_001198530.1 Intron NP_001185459.1
          NM_001198531.1 Intron NP_001185460.1
          NM_030756.4 Intron NP_110383.2
          XM_005270071.1 Intron XP_005270128.1
          XM_005270075.1 Intron XP_005270132.1
          XM_005270077.1 Intron XP_005270134.1
          XM_005270078.1 Intron XP_005270135.1
          XM_005270079.1 Intron XP_005270136.1
          XM_005270080.1 Intron XP_005270137.1
          XM_005270084.1 Intron XP_005270141.1
          XM_005270085.1 Intron XP_005270142.1
          XM_005270086.1 Intron XP_005270143.1
          XM_005270088.1 Intron XP_005270145.1
          XM_005270089.1 Intron XP_005270146.1
          XM_005270091.2 Intron XP_005270148.1
          XM_005270092.1 Intron XP_005270149.1
          XM_005270093.2 Intron XP_005270150.1
          XM_005270094.2 Intron XP_005270151.1
          XM_005270095.1 Intron XP_005270152.1
          XM_005270096.2 Intron XP_005270153.1
          XM_005270100.1 Intron XP_005270157.1
          XM_005270101.2 Intron XP_005270158.1
          XM_005270102.1 Intron XP_005270159.1
          XM_005270103.1 Intron XP_005270160.1
          XM_005270104.1 Intron XP_005270161.1
          XM_011540109.1 Intron XP_011538411.1
          XM_011540110.1 Intron XP_011538412.1
          XM_011540111.1 Intron XP_011538413.1
          XM_011540113.2 Intron XP_011538415.1
          XM_011540116.1 Intron XP_011538418.1
          XM_017016584.1 Intron XP_016872073.1
          XM_017016585.1 Intron XP_016872074.1
          XM_017016586.1 Intron XP_016872075.1
          XM_017016587.1 Intron XP_016872076.1
          XM_017016588.1 Intron XP_016872077.1
          XM_017016589.1 Intron XP_016872078.1
          XM_017016590.1 Intron XP_016872079.1
          XM_017016591.1 Intron XP_016872080.1
          XM_017016592.1 Intron XP_016872081.1
          XM_017016593.1 Intron XP_016872082.1
          XM_017016594.1 Intron XP_016872083.1
          XM_017016595.1 Intron XP_016872084.1
          XM_017016596.1 Intron XP_016872085.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          DNA-binding transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          blood vessel development
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          cell cycle arrest
          Wnt signaling pathway, calcium modulating pathway
          cell proliferation
          response to glucose
          positive regulation of heparan sulfate proteoglycan biosynthetic process
          pancreas development
          positive regulation of insulin secretion
          positive regulation of protein binding
          regulation of hormone metabolic process
          glucose homeostasis
          negative regulation of sequence-specific DNA binding transcription factor activity
          maintenance of DNA repeat elements
          canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition
          fat cell differentiation
          negative regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of protein export from nucleus
          myoblast fate commitment
          regulation of smooth muscle cell proliferation
          positive regulation of protein kinase B signaling
          canonical Wnt signaling pathway
          negative regulation of canonical Wnt signaling pathway
          beta-catenin-TCF complex assembly
          negative regulation of type B pancreatic cell apoptotic process
          negative regulation of extrinsic apoptotic signaling pathway
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          RNA polymerase II repressing transcription factor binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          beta-catenin binding
          transcription factor binding
          protein kinase binding
          nuclear hormone receptor binding
          sequence-specific DNA binding
          transcription regulatory region DNA binding
          gamma-catenin binding
          armadillo repeat domain binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-t4kr2:80/100.66.77.141:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0